Details of Virus RNA
| Virus RNA - Host Protein Network | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Regulation Network | |||||||||
| Full list of proteins interacting with the Not Specified Virus Region of this Strain | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| APOBEC1-binding protein 1 (HNRNPAB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Polyadenylate-binding protein 1 (PABPC1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein L (LGALS4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein U (HNRNPU) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| 40S ribosomal protein S7 (RPS6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| ELAV-like protein 1 (ELAVL1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| NonO protein (NONO) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 140 kDa nucleolar phosphoprotein (Nopp140) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| 28S ribosomal protein S5 (S5mt) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 28S ribosomal protein S7 (MRP-S7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 30 kDa splicing factor SMNrp (SMNDC1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| 39S ribosomal protein L11 (L11mt) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 39S ribosomal protein L13 (MRP-L13) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 39S ribosomal protein L2 (MRP-L2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 39S ribosomal protein L27 (L27mt) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 39S ribosomal protein L28 (MRP-L28) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 39S ribosomal protein L37 (L2mt) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 39S ribosomal protein L43 (L43mt) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 39S ribosomal protein L44 (MRP-L44) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 39S ribosomal protein S18a (Mrps18a) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 40S ribosomal protein S14 (RPS11) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 40S ribosomal protein S14 (RPS11) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| 40S ribosomal protein S15 (RPS14) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 40S ribosomal protein S18 (H4C1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 40S ribosomal protein S20 (RPS2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 40S ribosomal protein S3a (RPS3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 40S ribosomal protein S4, X isoform (RPS3A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 40S ribosomal protein S5 (RPS4X) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 40S ribosomal protein S6 (RPS5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 5'-3' exoribonuclease 1 (ACACA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L17 (RPL14) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L18 (H3-2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L19 (RPL18A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L22 (RPL21) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L26 (RPL24) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L27 (RPL26) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L29 (RPL28) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L3 (RPL29) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L30 (RPL3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L31 (RPL30) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L34 (RPL31) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L35a (RPL35) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| 60S ribosomal protein L6 (RPL5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Ataxin-2-like protein (A2RP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| ATP-binding cassette 50 (ABC50) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| AU-rich element RNA-binding protein 1 (AUF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Bcl-2-associated transcription factor 1 (Btf) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| BUD13 homolog (BUD13) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Cellular nucleic acid-binding protein (CNBP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Cold shock domain-containing protein E1 (CSDE1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| CPE-binding protein 4 (hCPEB-4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| CUGBP Elav-like family member 1 (CELF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| DAZ-associated protein 1 (DAZAP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| DEAD box protein 24 (DDX24) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| DEAD box protein 51 (DDX51) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| DEAD box protein 52 (MRM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| DEAD box protein 55 (KIAA1595) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| DEAD box protein 6 (DDX6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| DEAH box protein 30 (KIAA0890) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| DEAH box protein 30 (KIAA0890) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| DiGeorge syndrome critical region 8 (DGCR8) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| DNA dC->dU-editing enzyme APOBEC-3C (A3C) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| DNA repair protein XRCC6 (XRCC6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| DNA-directed RNA polymerase II RPB7 (hsRPB7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Double-stranded RNA-binding protein Staufen homolog 2 (STAU2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| E1B-55 kDa-associated protein 5 (E1B-AP5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| E2-induced gene 3 protein (GNL3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| E3 ubiquitin/ISG15 ligase TRIM25 (TRIM25) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| EBNA2 coactivator p100 (SND1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| eIF-3-theta (EIF3A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Eukaryotic translation initiation factor 3 subunit C (EIF3C) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Eukaryotic translation initiation factor 3 subunit D (EIF3D) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Eukaryotic translation initiation factor 3 subunit D (EIF3D) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Eukaryotic translation initiation factor 3 subunit G (EIF3G) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Eukaryotic translation initiation factor 3 subunit H (EIF3H) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Eukaryotic translation initiation factor 4B (EIF4B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Eukaryotic translation initiation factor 4H (EIF4H) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Exosome complex component RRP46 (EXOSC5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| FAST kinase domain-containing protein 2 (FASTKD2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| FAST kinase domain-containing protein 4 (TBRG4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| GAP SH3 domain-binding protein 1 (G3BP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| GAP SH3 domain-binding protein 2 (G3BP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| GAP-associated tyrosine phosphoprotein p62 (KHDRBS1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Gem-associated protein 5 (GEMIN5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Glutamate-rich WD repeat-containing protein 1 (GRWD1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Helicase A-binding protein 95 (HAP95) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Helicase MOV-10 (MOV10) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Helicase-like protein 2 (HLP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Helicase-like transcription factor (HLTF) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein H3 (HNRNPH3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein M (HNRNPM) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| hFXR2p (FXR2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Histone RNA hairpin-binding protein (SLBP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| HUMAN la-related protein 1 (LARP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| IF-4-gamma 1 (EIF4G1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| IGF2-binding protein 2 (IMP-2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| IGF2-binding protein 3 (IMP-3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Interferon-regulated antiviral protein (IRAV) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Vero cells (epithelial kidney cell) (CVCL_0059 ) | ||||||||
| Cell Originated Tissue | kidney | ||||||||
| Interaction Score | adj. p_value < 0.05 | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Interleukin enhancer-binding factor 2 (ILF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Interleukin enhancer-binding factor 3 (ILF3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| La-related protein 4 (LARP4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| La-related protein 7 (LARP7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Leucine-rich repeat-containing protein 47 (LRRC47) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Lupus La protein (SSB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Matrin-3 (MATR3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Methionine aminopeptidase 2 (METAP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Microtubule-associated protein 4 (MAP4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| NF-kappa-B-repressing factor (NKRF) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Nipped-B-like protein (NIPBL) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Nucleolar protein 12 (YWHAE) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Nucleolar RNA helicase 2 (DDX21) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Nucleolysin TIAR (TIAL1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Nucleophosmin (NPM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Nucleophosmin (NPM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Oxidative stress-associated Src activator (OSSA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| P21- and CDK-associated protein 1 (TOK1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| PAI1 RNA-binding protein 1 (PAI-RBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| PAI1 RNA-binding protein 1 (PAI-RBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Paraspeckle component 1 (PSPC1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Peptidyl-prolyl cis-trans isomerase G (PPIG) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Peptidyl-prolyl cis-trans isomerase-like 4 (PPIL4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| PHD finger protein 6 (PHF6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Poly [ADP-ribose] polymerase 12 (PARP12) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Poly(A) RNA polymerase | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Poly(rC)-binding protein 1 | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Polyadenylate-binding protein 2 (PABPN1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Polyadenylate-binding protein 4 (PABPC4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Polyadenylate-binding protein 4 (PABPC4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Polypyrimidine tract-binding protein 3 (PTBP3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Positive cofactor 4 (PC4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| PP-1B (HNRNPUL2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Pre-mRNA-processing factor 17 (CDC40) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Protein FAM98A (FAM98A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Protein kinase A-anchoring protein 1 (PRKA1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Protein kinase C inhibitor protein 1 (KCIP-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Protein lin-28 homolog B (LIN28B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Protein quaking (QKI) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Protein SDA1 homolog (SDAD1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Pseudouridylate synthase 1 homolog (PUS1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Pumilio homolog 1 (PUM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Pumilio homolog 1 (PUM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Pumilio homolog 2 (PUM2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Ran-binding protein 21 (XPO5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Regulator of nonsense transcripts 1 (NORF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Ribonuclease 3 (DROSHA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Ribosome maturation protein SBDS (SBDS) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| RNA binding protein fox-1 homolog 2 (RPS17) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| RNA helicase-related protein (RNAHP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| RNA pseudouridylate synthase domain-containing (RPUSD3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| RNA-binding protein 15 (RBM15) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| RNA-binding protein 3 (RBM3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| RNA-binding protein 47 (RBM47) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| RNA-binding protein 5 (G15) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| RNA-binding protein EWS (EWSR1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| RNA-binding protein FUS (FUS) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| RNA-binding protein Raly (RALY) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| SAFB-like transcription modulator (SLTM) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Scaffold attachment factor B1 (SAFB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Scaffold attachment factor B2 (SAFB2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Sequestosome-1 p62 (SQSTM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| SNU114 homolog (hSNU114) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Spinocerebellar ataxia type 2 protein (SCA2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Spliceosome-associated protein 155 (SF3B1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| splicing factor (PSF) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| splicing factor (PSF) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Splicing factor U2AF 35 kDa subunit (U2AF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Substrate of AIM1/Aurora kinase B (NSUN2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Suppressor of var1 3-like protein 1 (SUV3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Synaptic functional regulator FMR1 (FMR1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| T-cell-restricted intracellular antigen-1 (TIA-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Thyroid hormone receptor-associated protein 3 (THRAP3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Transcriptional activator protein Pur-alpha (PURA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Transformer-2 protein homolog alpha (TRA2A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| TROVE domain family member 2 (TROVE2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| U7 snRNA-associated Sm-like protein LSm11 (LSM11) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Ubiquitin C-terminal hydrolase UCH37 (UCHL5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Ubiquitin-associated protein 2-like (UBAP2L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| WD repeat-containing protein 3 (WDR3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| WD repeat-containing protein 43 (WDR43) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| WD repeat-containing protein 50 (UTP18) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| WD splicing factor Prp4 (hPrp4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Werner syndrome ATP-dependent helicase (WRN) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Y-box-binding protein 1 (YBX1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Y-box-binding protein 3 (YBX3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Zinc finger CCCH domain-containing protein 11A (ZC3H11A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Zinc finger CCCH domain-containing protein 8 (ZC3H8) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Zinc finger CCCH-type antiviral protein 1 (ZC3HAV1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 12h; 24; 36h; 48h | ||||||||
| Infection Cells | HCT-8 cells (Human ileocaecal adenocarcinoma cell) (CVCL_2478 ) | ||||||||
| Cell Originated Tissue | Ileocecum | ||||||||
| Interaction Score | p_value < 0.05; FDR < 10% | ||||||||
| Description of Detection Method | Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
| Zinc finger protein 622 (ZNF622) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[2] | |||||||
| Infection Cells | K562 cells (Human leukemic cell line) (CVCL_0004 ) | ||||||||
| Cell Originated Tissue | Bone marrow | ||||||||
| Interaction Type | Potential binding protein | ||||||||
| Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
| Virus RNA Sequence Information (Source: GeneBank) |
>NC_006213.1 Human coronavirus OC43 strain ATCC VR-759, complete genome
ATTGTGAGCGATTTGCGTGCGTGCATCCCGCTTCACTGATCTCTTGTTAGATCTTTTTGTAATCTAAACT TTATAAAAACATCCACTCCCTGTAATCTATGCTTGTGGGCGTAGATTTTTCATAGTGGTGTTTATATTCA TTTCTGCTGTTAACAGCTTTCAGCCAGGGACGTGTTGTATCCTAGGCAGTGGCCCGCCCATAGGTCACAA TGTCGAAGATCAACAAATACGGTCTCGAACTACACTGGGCTCCAGAATTTCCATGGATGTTTGAGGACGC AGAGGAGAAGTTGGATAACCCTAGTAGTTCAGAGGTGGATATGATTTGCTCCACCACTGCGCAAAAGCTG GAAACAGACGGAATTTGTCCTGAAAATCATGTGATGGTGGATTGTCGCCGACTTCTTAAACAAGAGTGTT GTGTGCAGTCTAGCCTAATACGTGAAATTGTTATGAATGCAAGTCCATATGATTTGGAGGTGCTACTTCA AGATGCTTTGCAGTCCCGTGAAGCAGTTTTGGTTACAACCCCCTTAGGTATGTCTTTAGAGGCATGCTAT GTGAGAGGTTGTAATCCTAAAGGATGGACCATGGGTTTGTTTCGGCGTAGAAGTGTGTGTAACACTGGTC GTTGCACTGTTAATAAGCATGTGGCCTATCAGTTATATATGATTGATCCTGCAGGTGTCTGTCTTGGTGC AGGTCAATTCGTGGGTTGGGTCATACCCTTAGCCTTTATGCCTGTGCAATCCCGGAAATTTATTGTTCCA TGGGTTATGTACTTGCGTAAGCGTGGCGAAAAGGGTGCTTACAATAAAGATCATGGACGTGGCGGTTTTG GACATGTTTATGATTTTAAAGTTGAAGATGCTTATGACCAGGTGCATGATGAGCCTAAGGGTAAGTTTTC TAAGAAGGCTTATGCTTTAATTAGAGGGTATCGTGGTGTTAAACCACTTCTCTATGTAGACCAGTATGGT TGTGATTATACTGGTAGTCTTGCAGATGGCTTAGAGGCTTATGCTGATAAGACATTGCAAGAAATGAAGG CATTATTTCCTACTTGGAGTCAGGAACTCCTTTTTGATGTAATTGTGGCATGGCATGTTGTGCGTGATCC ACGTTATGTTATGAGATTGCAGAGTGCTGCTACTATACGTAGTGTTGCATATGTTGCTAATCCTACTGAA GACTTGTGTGATGGTTCTGTTGTTATAAAAGAACCTGTGCATGTTTATGCAGATGACTCTATTATTTTAC GTCAATATAATTTAGTTGACATTATGAGTCATTTTTATATGGAGGCAGATACAGTTGTAAATGCTTTTTA TGGTGTTGCTTTGAAAGATTGCGGTTTTGTTATGCAGTTTGGTTACATTGATTGCGAACAAGACTCGTGT GATTTTAAAGGTTGGATTCCTGGTAACATGATAGATGGTTTTGCTTGCACCACTTGTGGTCATGTTTATG AAGTAGGTGATTTGATGGCACAATCTTCAGGTGTTTTGCCTGTTAACCCTGTATTGCATACTAAGAGTGC AGCAGGCTATGGTGGTTTTGGTTGTAAAGATTCTTTTACTCTGTATGGCCAAACTGTAGTTTATTTTGGA GGTTGTGTGTATTGGAGTCCAGCACGTAATATATGGATTCCTATATTAAAATCCTCTGTTAAGTCATATG ACAGTTTGGTTTATACTGGAGTTTTAGGTTGCAAGGCTATTGTAAAGGAAACAAATCTCATTTGCAAAGC TTTGTACCTTGATTATGTTCAACACAAGTGTGGCAATTTACACCAACGGGAGTTGCTAGGTGTTTCAGAT GTGTGGCATAAACAATTGCTATTAAATAGAGGTGTTTATAAACCTCTGTTAGAGAATATTGATTATTTTA ATATGCGGCGCGCTAAATTTAGTTTAGAAACTTTTACTGTTTGTGCAGATGGCTTTATGCCTTTTCTTTT AGATGATTTAGTTCCACGCGCATATTATTTGGCAGTAAGTGGTCAAGCATTTTGTGATTATGCAGATAAA CTTTGCCATGCCGTTGTGTCTAAGAGTAAAGAGTTACTTGATGTGTCTCTGGATTCTTTAGGTGCAGCTA TACATTATTTGAATTCTAAGATTGTTGATTTGGCTCAACATTTTAGTGATTTTGGAACAAGTTTCGTTTC TAAAATTGTTCATTTCTTTAAGACTTTTACTACTAGCACTGCTCTTGCATTTGCATGGGTTTTATTTCAT GTTTTGCATGGTGCTTATATAGTAGTGGAGAGTGATATATATTTTGTTAAAAACATTCCTCGTTATGCTA GTGCTGTTGCACAAGCATTTCAGAGTGTTGCTAAAGTTGTACTGGACTCTTTAAGAGTTACTTTTATTGA TGGCCTTTCTTGTTTTAAGATTGGACGTAGAAGAATTTGTCTTTCAGGCAGAAAAATTTATGAAGTTGAG CGTGGCTTGTTACATTCATCCCAATTGCCATTAGATGTTTATGATTTAACCATGCCTAGTCAAGTTCAGA AAGCCAAGCAAAAACCTATTTATTTAAAAGGTTCTGGTTCTGATTTTTCATTAGCGGATAGTGTAGTTGA AGTTGTTACAACTTCACTTACACCATGTGGTTATTCTGAACCACCTAAAGTTGCAGCTAAAATTTGCATT GTGGATAATGTTTATATGGCCAAGGCTGGTGACAAATATTACCCTGTTGTGGTTGATGATCATGTTGGAC TCTTGGATCAAGCATGGAGAGTTCCTTGTGCTGGAAGGCGTGTTACATTTAAGGAACAGCCTACAGTAAA GGAGATTATAAGCATGCCTAAGATTATTAAGGTTTTTTATGAGCTTGACAACGATTTTAATACTATTTTA AATACTGCGTGTGGAGTGTTTGAAGTGGATGATACTGTTGATATGGAGGAATTTTATGCTGTGGTGATTG ATGCCATAGAAGAGAAACTTTCTCCATGTAAGGAGCTTGAAGGTGTAGGTGCTAAAGTTAGTGCCTTTTT ACAGAAATTAGAGGATAATCCCCTATTTTTATTTGATGAGGCTGGCGAGGAAGTTCTTGCTCCTAAATTG TATTGTGCCTTTACAGCTCCTGAAGATGATGACTTTCTTGAGGAAAGTGATGTTGAAGAAGATGATGTAG AAGGTGAGGAAACTGATTTAACTGTCACAAGTGCTGGACAGCCTTGTGTTGCTAGTGAACAGGAGGAGTC TTCTGAAGTCTTAGAGGACACTTTGGATGATGGTCCAAGTGTGGAGACATCTGATTCACAAGTTGAAGAA GATGTAGAAATGTCGGATTTTGTTGATCTTGAATCTGTGATTCAGGATTATGAAAATGTTTGTTTTGAGT TTTATACTACAGAGCCAGAATTTGTTAAAGTTTTGGGTCTGTATGTGCCTAAAGCAACTCGCAACAATTG CTGGTTGCGATCAGTTTTGGCAGTGATGCAGAAATTGCCCTGTCAATTTAAAGATAAAAATTTGCAGGAT CTTTGGGTGTTATACAAGCAACAGTATAGTCAGTTGTTTGTTGATACCTTGGTTAATAAGATACCTGCTA ATATTGTACTTCCACAAGGTGGTTATGTTGCTGATTTTGCATATTGGTTTTTAACCTTATGTGATTGGCA GTGTGTTGCATACTGGAAATGCATTAAATGTGATTTAGCTCTTAAGCTTAAAGGCTTGGATGCTATGTTC TTTTATGGTGATGTTGTTTCACATATATGCAAGTGTGGTGAGTCTATGGTACTTATTGATGTTGATGTGC CATTTACAGCCCACTTTGCTCTTAAAGATAAGTTGTTTTGTGCATTTATTACTAAGCGTATTGTGTATAA AGCAGCTTGTGTTGTGGATGTTAATGATAGTCATTCTATGGCTGTTGTTGATGGTAAACAAATTGATGAT CATCGTATCACTAGTATTACTAGTGATAAGTTTGATTTTATTATTGGGCATGGTATGTCATTTTCAATGA CTACTTTTGAAATTGCCCAATTGTATGGTTCTTGTATAACACCTAATGTGTGTTTTGTTAAAGGTGATAT AATTAAAGTATCTAAGCTTGTTAAAGCAGAAGTTGTTGTAAACCCTGCTAATGGCCATATGGCACATGGT GGTGGTGTTGCAAAAGCTATTGCAGTAGCAGCTGGACAGCAGTTTGTTAAAGAGACTACCGATATGGTTA AGTCTAAAGGAGTTTGTGCTACTGGAGATTGTTATGTCTCTACAGGGGGCAAATTATGTAAAACTGTGCT TAATGTTGTTGGACCTGATGCGAGAACACAGGGTAAACAAAGTTATGTATTGTTAGAGCGTGTTTATAAA CATCTTAACAACTATGACTGTGTTGTTACAACTTTGATCTCAGCTGGTATATTTAGTGTGCCTTCTGATG TGTCTTTAACATATCTACTTGGTACTGCTAAGAAACAAGTTGTTCTTGTTAGCAATAATCAAGAGGATTT TGATCTTATTTCTAAGTGTCAGATAACTGCTGTTGAGGGCACTAAGAAATTGGCAGCGCGTCTTTCTTTT AATGTTGGACGTTCCATTGTTTACGAAACAGATGCTAATAAGTTGATTTTAATCAATGACGTTGCATTTG TTTCGACATTTAATGTTTTACAGGATGTTTTATCCTTAAGACATGATATAGCACTTGATGATGATGCACG AACCTTCGTTCAGAGCAATGTTGATGTTGTACCTGAGGGTTGGCGTGTTGTCAATAAGTTTTATCAAATT AATGGTGTTAGAACCGTTAAGTATTTTGAGTGTACTGGAGGCATAGATATATGCAGCCAGGATAAAGTTT TTGGTTATGTACAGCAGGGTATTTTTAATAAGGCTACTGTTGCTCAAATTAAAGCCTTGTTTTTGGATAA AGTGGACATCTTGCTAACTGTTGATGGTGTTAATTTCACTAATAGGTTTGTGCCTGTTGGTGAAAGTTTT GGTAAGAGTCTAGGAAATGTGTTTTGTGATGGAGTTAATGTCACGAAGCATAAGTGTGATATAAATTATA AAGGTAAAGTCTTTTTCCAGTTTGATAATCTTTCTAGTGAAGATTTAAAGGCTGTAAGAAGTTCCTTTAA TTTTGATCAGAAGGAATTGCTTGCCTATTACAACATGCTTGTTAATTGTTTTAAGTGGCAGGTTGTTGTT AATGGTAAGTATTTCACTTTTAAGCAAGCTAATAACAATTGTTTTGTTAATGTTTCTTGCTTAATGCTCC AGAGTTTGCATCTGACATTTAAAATTGTTCAATGGCAAGAGGCATGGCTTGAATTTCGTTCTGGCCGCCC TGCTAGATTTGTAGCTTTGGTTTTGGCCAAAGGTGGGTTTAAATTTGGAGATCCTGCTGATTCTAGAGAT TTCTTGCGTGTTGTGTTTAGTCAAGTTGATTTGACTGGGGCAATATGTGATTTTGAAATTGCATGTAAAT GTGGTGTAAAGCAGGAACAGCGTACTGGTCTGGACGCTGTTATGCATTTTGGTACATTGAGTCGTGAAGA TCTTGAGATTGGTTATACCGTGGACTGTTCTTGCGGTAAAAAGCTAATTCATTGTGTACGATTTGATGTA CCATTTTTAATTTGCAGTAATACACCTGCTAGTGTAAAATTACCTAAGGGTGTAGGAAGTGCAAATATTT TTATAGGTGATAAGGTTGGTCATTATGTTCATGTTAAGTGTGAACAATCTTATCAGCTTTATGATGCTTC TAATGTTAAGAAGGTTACAGATGTTACTGGCAAGTTGTCAGATTGTCTGTATCTTAAAAATTTGAAACAA ACTTTTAAATCGGTGTTAACCACCTATTATTTGGATGATGTTAAGAAAATTGAGTATAAACCTGACTTGT CACAATATTATTGTGACGGAGGTAAGTATTATACTCAGCGTATTATTAAAGCCCAATTTAAAACATTCGA GAAAGTAGATGGTGTGTATACTAATTTTAAATTGATAGGACACACCGTCTGTGACAGTCTTAATGCTAAG TTGGGTTTTGATAGCTCTAAAGAGTTTGTTGAATATAAGATTACTGAGTGGCCAACAGCTACAGGTGATG TGGTGTTGGCTACTGATGATTTGTATGTTAAGAGATATGAGAGGGGTTGTATTACTTTTGGTAAACCTGT TATATGGTTAAGCCATGAGAAAGCTTCCCTCAATTCTTTAACATATTTTAATAGACCTTCATTGGTTGAT GATAATAAATTTGATGTTTTAAAAGTGGATGATGTTGACGATGGTGGTGACAGCTCAGAGAGTGGTGCCA AAGAAACCAAAGAAATCAACATTATTAAGTTAAGTGGTGTTAAAAAACCATTTAAGGTTGAAGATAGTGT CATTGTTAATGATGATACTAGTGAAACCAAATATGTTAAGAGTTTGTCTATTGTTGATGTGTATGATATG TGGCTTACAGGTTGTAAGTATGTTGTTAGAACTGCTAATGCTTTGAGCAGAGCAGTTAACGTACCTACAA TACGTAAGTTTATAAAATTTGGTATGACTCTTGTTAGTATACCAATTGATTTGTTAAATTTAAGAGAGAT TAAGCCTGCTGTTAATGTGGTTAAAGCTGTGCGAAATAAAATTTCTGTATGCTTTAATTTTATTAAATGG CTTTTTGTCTTATTATTTGGCTGGATTAAAATATCCGCTGATAATAAAGTAATCTACACCACAGAAATTG CATCAAAGCTTACGTGTAAGCTTGTAGCTTTAGCTTTTAAAAATGCATTTTTGACATTTAAGTGGAGTAT GGTTGCTAGAGGTGCTTGCATTATAGCGACTATATTTCTATTGTGGTTTAATTTTATATATGCCAATGTA ATTTTTAGTGATTTTTATTTGCCTAAAATCGGTTTCTTGCCGACTTTTGTTGGTAAGATTGCACAGTGGA TTAAGAACACTTTTAGTCTTGTAACTATTTGTGATCTATATTCCATTCAGGATGTGGGTTTTAAGAATCA GTATTGTAATGGAAGTATTGCATGTCAGTTCTGCTTGGCAGGATTTGATATGTTAGATAATTATAAAGCC ATTGATGTAGTACAGTATGAAGCTGATAGGAGAGCATTTGTTGATTATACAGGTGTGTTAAAGATTGTCA TTGAATTGATAGTTAGTTACGCCCTGTATACGGCATGGTTTTATCCATTGTTTGCCCTTATCAGTATTCA GATCTTGACCACTTGGCTGCCTGAGCTTTTTATGCTTAGTACATTACATTGGAGTTTTAGGTTGCTGGTG GCTTTAGCTAATATGTTACCAGCACATGTGTTTATGAGGTTTTATATTATTATTGCCTCTTTTATTAAGC TCTTTAGCTTGTTTAGGCATGTTGCCTATGGTTGTAGTAAATCTGGTTGTTTGTTTTGTTACAAGAGGAA TCGTAGTCTACGTGTTAAATGTAGTACTATCGTTGGTGGCATGATACGCTATTACGATGTTATGGCTAAT GGTGGCACTGGCTTTTGTTCAAAACATCAATGGAATTGCATTGATTGTGATTCTTATAAACCAGGTAATA CTTTTATTACTGTTGAGGCCGCTCTTGATCTATCTAAGGAATTGAAACGGCCCATTCAGCCTACAGATGT TGCTTATCATACGGTTACTGATGTTAAGCAAGTTGGTTGTTCTATGCGCTTGTTCTATGATCGTGATGGA CAGCGCACATATGATGATGTTAATGCTAGTTTGTTTGTGGATTATAGTAATTTGCTACATTCTAAGGTTA AGAGTGTGCCTAATATGCATGTTGTGGTAGTGGAAAATGATGCTGATAAAGCCAATTTTCTGAATGCTGC TGTATTTTATGCACAGTCTTTGTTTAGACCTATTTTAATGGTTGATAAAAATCTGATAACTACTGCTAAC ACTGGTACGTCTGTTACAGAAACTATGTTTGATGTTTATGTGGATACATTTTTGTCTATGTTTGATGTGG ATAAAAAGAGTCTTAATGCTTTAATAGCAACTGCGCATTCTTCTATAAAACAGGGTACGCAGATTTATAA AGTTTTGGATACCTTTTTAAGCTGTGCTCGTAAAAGTTGTTCTATTGATTCAGATGTTGATACTAAGTGT TTAGCTGATTCTGTCATGTCTGCTGTATCGGCAGGTCTTGAATTGACGGATGAAAGTTGTAATAACTTGG TGCCAACATATTTGAAGAGTGACAACATTGTGGCAGCTGATTTAGGTGTTCTGATTCAAAATTCTGCAAA GCATGTGCAGGGTAATGTTGCTAAAATAGCTGGTGTTTCCTGTATATGGTCTGTGGATGCTTTTAATCAG TTTAGTTCTGATTTCCAGCATAAATTGAAGAAAGCATGTTGTAAAACTGGTTTGAAACTGAAGCTTACTT ATAATAAGCAGATGGCTAATGTCTCTGTTTTAACTACACCCTTTAGTCTTAAAGGGGGTGCAGTTTTTAG TTATTTTGTTTATGTGTGTTTTGTGTTGAGTTTGGTCTGTTTTATTGGACTGTGGTGCTTAATGCCCACT TACACAGTACACAAATCAGATTTTCAGCTTCCCGTTTATGCCAGTTATAAAGTTTTAGATAATGGTGTTA TTAGAGATGTTAGCGTTGAAGATGTTTGTTTCGCTAACAAATTTGAACAATTTGATCAATGGTATGAGTC TACATTTGGTCTAAGTTATTATAGTAACAGTATGGCTTGTCCCATTGTTGTTGCTGTAATAGATCAGGAT TTTGGCTCTACAGTGTTTAATGTCCCTACCAAAGTGTTACGATATGGTTATCATGTGTTGCACTTTATTA CACATGCACTTTCTGCTGATGGAGTGCAGTGTTATACGCCACATAGTCAAATATCGTATTCTAATTTTTA TGCTAGTGGCTGTGTGCTTTCCTCTGCTTGCACTATGTTTACAATGGCCGATGGTAGTCCACAACCTTAT TGTTATACAGAGGGGCTTATGCAAAATGCTTCTCTGTATAGTTCATTGGTACCTCACGTGCGGTATAATC TTGCTAATGCTAAAGGTTTTATCCGTTTTCCAGAAGTGTTGCGAGAAGGGCTTGTACGTATCGTGCGTAC TCGTTCTATGTCGTATTGCAGAGTTGGATTATGTGAGGAAGCTGATGAGGGTATATGCTTTAATTTTAAT GGTTCTTGGGTGCTTAATAATGATTATTATAGATCATTGCCTGGGACCTTTTGTGGTAGAGATGTTTTTG ATTTAATTTATCAGCTATTTAAAGGTTTAGCACAGCCTGTGGATTTTTTGGCATTGACTGCTAGTTCCAT TGCTGGTGCTATACTCGCTGTAATTGTTGTTTTGGTGTTTTATTACCTAATAAAGCTTAAACGTGCTTTT GGTGATTACACCAGTGTTGTTTTTGTTAACGTGATTGTGTGGTGTGTAAATTTTATGATGCTTTTTGTGT TTCAAGTTTACCCCATACTTTCTTGTGTATATGCTATTTGTTATTTTTATGCCACGCTTTATTTCCCTTC GGAGATAAGTGTGATAATGCACTTACAATGGCTAGTTATGTATGGCACTATTATGCCTTTATGGTTTTGT TTGCTATATATAGCTGTTGTTGTTTCAAATCATGCTTTTTGGGTATTTTCTTACTGCAGAAAGCTTGGTA CTTCTGTTCGTAGTGATGGTACATTTGAAGAAATGGCTCTCACTACTTTTATGATTACAAAAGATTCTTA TTGTAAGCTTAAGAATTCTTTGTCTGATGTTGCTTTTAATAGATATTTGAGTTTGTATAATAAATATAGG TATTACAGCGGTAAAATGGATACTGCTGCATATAGGGAGGCTGCTTGCTCTCAGTTGGCTAAAGCAATGG ACACATTTACCAATAATAATGGTAGTGATGTGCTTTACCAACCGCCTACTGCTTCCGTCTCAACTTCATT CTTGCAATCTGGTATTGTGAAAATGGTAAATCCTACTTCTAAGGTAGAACCATGTGTTGTCAGTGTTACC TATGGTAATATGACATTGAATGGTTTATGGTTGGATGACAAGGTCTACTGTCCCAGACATGTAATATGTT CTGCTTCAGATATGACTAATCCAGATTATACAAATTTGTTGTGTAGAGTAACATCAAGTGATTTTACTGT ATTGTTTGATCGTCTAAGCCTTACAGTGATGTCTTATCAAATGCGGGGTTGTATGCTTGTTCTTACAGTG ACCCTGCAAAATTCTCGTACGCCAAAATATACATTTGGTGTGGTTAAACCTGGTGAGACTTTTACTGTTT TAGCTGCTTATAACGGCAAACCACAAGGAGCCTTTCATGTAACTATGCGTAGTAGTTATACCATTAAGGG TTCCTTTTTATGCGGATCTTGTGGATCTGTTGGTTATGTAATAATGGGTGATTGTGTTAAATTTGTTTAT ATGCATCAATTGGAGCTTAGTACTGGTTGTCATACTGGTACTGACTTCAATGGGGATTTTTATGGTCCTT ATAAGGATGCTCAGGTTGTTCAGTTGCTCATTCAGGATTATATACAATCTGTTAATTTTGTAGCATGGCT TTATGCTGCTATACTTAACAATTGTAATTGGTTTGTACAAAGTGATAAGTGTTCTGTAGAAGATTTTAAT GTGTGGGCTCTGTCCAATGGATTTAGCCAAGTTAAATCTGACCTTGTTATAGATGCTTTAGCTTCTATGA CTGGTGTGTCTTTGGAAACACTGTTGGCTGCTATTAAGCGTCTTAAGAATGGTTTCCAAGGACGTCAGAT TATGGGTAGTTGCTCTTTTGAGGATGAATTGACACCTAGCGATGTTTATCAACAACTCGCTGGTATCAAG TTACAATCAAAACGCACTAGATTGTTTAAAGGCACTGTTTGTTGGATTATGGCTTCTACATTTTTGTTTA GTTGCATAATTACAGCATTTGTGAAATGGACTATGTTTATGTATGTAACTACTAATATGTTTAGTATTAC GTTTTGTGCACTTTGTGTTATAAGTTTGGCCATGTTGTTGGTTAAGCATAAGCATCTTTATTTGACTATG TATATAACTCCTGTGCTTTTTACACTGTTGTATAACAACTATTTGGTTGTGTACAAGCATACATTTAGAG GCTATGTCTATGCATGGCTATCATATTATGTTCCATCAGTTGAGTACACTTATACTGATGAAGTTATTTA TGGCATGTTATTGCTTGTAGGAATGGTCTTTGTTACATTACGTAGCATTAACCATGATTTGTTTTCTTTT ATAATGTTTGTTGGTCGTTTGATTTCTGTTTTCTCTTTGTGGTACAAGGGTTCTAACTTAGAGGAAGAAA TTCTTCTTATGTTGGCTTCCCTTTTTGGTACTTACACATGGACAACAGTTTTATCTATGGCTGTAGCAAA GGTTATTGCTAAGTGGGTTGCTGTGAATGTCTTGTATTTCACAGATATACCTCAAATTAAGATAGTGCTT TTGTGCTATTTGTTTATTGGTTATATTATTAGCTGTTATTGGGGCTTGTTTTCCTTGATGAACAGTTTGT TTAGAATGCCTTTGGGTGTTTATAATTATAAAATTTCAGTACAGGAATTAAGATATATGAATGCTAATGG ATTGCGCCCTCCTAAGAATAGTTTTGAAGCCCTTATGCTTAATTTTAAGCTGTTGGGTATTGGAGGTGTT CCAATCATTGAAGTATCTCAATTTCAATCAAAATTGACTGATGTCAAATGTGCTAATGTCGTCTTGCTTA ATTGCTTGCAACATTTGCATGTTGCTTCTAATTCTAAGTTGTGGCATTATTGTAGCACTTTGCACAATGA AATACTTGCCACTTCGGATCTGAGTGTTGCTTTTGAAAAGCTTGCTCAGTTATTAATTGTTTTGTTTGCT AATCCAGCTGCTGTGGATAGCAAGTGCCTGACTAGTATTGAAGAAGTTTGCGATGATTACGCAAAGGACA ATACTGTTTTGCAGGCTTTACAGAGTGAATTTGTTAATATGGCTAGCTTCGTTGAATATGAAGTTGCTAA GAAAAATCTTGATGAGGCGCGTTTTAGTGGTTCTGCTAATCAACAGCAGTTAAAACAGCTAGAGAAAGCC TGTAATATTGCTAAATCTGCTTATGAACGCGACCGTGCTGTAGCAAAAAAGTTGGAGCGTATGGCTGATT TGGCTCTCACTAATATGTATAAAGAAGCTAGAATTAATGATAAGAAGAGTAAGGTTGTTTCTGCCTTGCA AACTATGCTTTTTAGTATGGTGCGTAAGTTAGATAATCAAGCTCTGAATTCAATATTAGATAACGCTGTG AAGGGTTGTGTACCATTGAATGCAATACCTTCATTGGCAGCAAATACTCTGAATATAATTGTACCAGATA AAAGTGTTTATGACCAGGTAGTTGATAATGTCTATGTTACCTATGCGGGTAATGTATGGCAGATTCAAAC TATCCAGGATTCAGATGGTACAAATAAGCAGTTGAATGAGATATCTGATGATTGTAACTGGCCACTAGTT ATTATTGCAAATCGGTATAATGAGGTATCTGCTACTGTTTTGCAAAATAATGAATTAATGCCTGCTAAGT TGAAAATTCAGGTTGTTAATAGTGGTCCAGATCAGACTTGTAATACACCTACTCAATGTTACTATAATAA TAGTAACAATGGGAAGATTGTTTATGCTATACTTAGTGATGTTGATGGTCTTAAGTATACAAAAATTCTT AAAGATGATGGCAATTTTGTTGTTTTGGAGTTAGATCCTCCTTGTAAATTTACTGTTCAAGATGCTAAAG GTCTTAAAATTAAGTACCTTTATTTTGTAAAAGGTTGTAACACACTAGCAAGAGGCTGGGTTGTTGGTAC AATTTCTTCTACAGTTAGATTGCAAGCTGGAACTGCTACTGAATATGCTTCCAACTCATCTATATTGTCT TTATGTGCGTTTTCTGTAGATCCTAAGAAAACGTATTTAGATTTTATACAACAAGGAGGAACACCTATTG CCAATTGTGTTAAAATGTTGTGTGACCATGCTGGTACCGGTATGGCCATTACTGTTAAACCCGATGCTAC CACTAGTCAGGATTCATATGGTGGTGCGTCTGTTTGTATATATTGCCGCGCACGAGTTGAACACCCAGAT GTTGATGGGTTGTGCAAATTACGCGGCAAGTTTGTACAAGTGCCTGTAGGTATAAAAGATCCTGTGTCTT ATGTTTTGACACATGATGTTTGTCGAGTTTGTGGATTTTGGCGGGATGGAAGTTGTTCATGTGTTAGCAC TGACACTACTGTTCAATCAAAAGATACTAATTTTTTAAACGGGTTCGGGGTACGAGTGTAGATGCCCGTC TCGTACCCTGCGCCAGTGGTTTATCTACTGATGTACAATTAAGGGCATTTGATATTTACAATGCTAGTGT TGCTGGCATTGGTTTACATTTAAAAGTTAATTGTTGCCGTTTTCAGCGTGTTGATGAGAACGGTGATAAA TTAGATCAGTTCTTTGTTGTTAAGAGGACAGATCTGACTATATATAATAGAGAGATGAAATGCTATGAGC GTGTAAAAGATTGTAAGTTTGTGGCTGAACACGATTTCTTTACATTTGATGTAGAAGGTAGTCGTGTGCC ACACATTGTACGCAAGGATTTAACAAAGTATACTATGTTGGATCTTTGCTATGCATTGCGACATTTTGAT CGCAATGATTGCATGCTGCTTTGTGACATTCTCTCTATATATGCTGGTTGTGAACAATCCTACTTTACTA AGAAGGATTGGTATGATTTTGTTGAAAATCCTGATATTATTAATGTGTATAAAAAGCTAGGACCTATTTT TAATAGAGCCCTAGTTAGCGCTACTGAGTTTGCGGACAAATTGGTGGAGGTAGGCTTAGTAGGCGTTTTA ACACTTGATAATCAAGATTTAAATGGTAAATGGTATGATTTTGGTGACTATGTTATTGCAGCCCCAGGAT GTGGTGTTGCTATAGCAGATTCTTATTATTCTTATATCATGCCTATGCTGACCATGTGTCATGCATTGGA TTGCGAATTGTATGTGAATAATGCTTATAGACTATTTGATCTTGTACAGTATGATTTTACTGATTACAAG CTTGAATTGTTTAATAAGTATTTTAAGCACTGGAGTATGCCATATCATCCTAACACTGTTGATTGTCAGG ATGATCGGTGTATTATACATTGTGCTAATTTTAACATACTTTTTAGTATGGTTTTACCTAATACATGTTT TGGGCCTCTTGTTAGGCAAATTTTTGTGGATGGTGTGCCTTTTGTTGTTTCAATTGGCTACCATTATAAA GAACTTGGTATTGTGATGAATATGGATGTGGATACACATCGTTATCGCTTGTCTTTAAAAGACTTGCTTT TATATGCTGCTGATCCAGCTTTGCATGTAGCTTCTGCTAGTGCATTGTATGATTTACGCACTTGCTGTTT TAGTGTTGCCGCTATAACAAGCGGTGTAAAATTTCAAACAGTTAAACCTGGTAATTTTAATCAGGATTTT TATGATTTTGTTTTAAGTAAAGGCCTGCTTAAAGAGGGTAGCTCAGTTGATCTGAAGCACTTTTTCTTTA CACAGGATGGTAATGCTGCTATTACTGATTATAATTATTATAAGTATAATTTGCCCACCATGGTGGACAT TAAGCAGTTGTTGTTTGTTTTGGAAGTTGTTTATAAGTATTTTGAGATTTATGATGGTGGGTGTATACCG GCATCACAAGTCATTGTTAATAATTATGATAAGAGTGCTGGCTATCCATTTAACAAATTTGGAAAAGCCA GGCTCTATTATGAAGCATTATCATTTGAGGAACAGGATGAAATTTACGCTTATACTAAGCGTAATGTCCT GCCAACACTTACTCAAATGAATTTGAAATATGCTATTAGTGCTAAGAATAGAGCCCGCACTGTTGCTGGT GTTTCCATACTTAGTACTATGACTGGCAGAATGTTTCATCAAAAATGTTTGAAAAGTATAGCAGCTACAC GTGGTGTTCCTGTAGTTATAGGCACCACTAAATTTTATGGTGGCTGGGATGATATGTTACGCCGCCTTAT TAAAGATGTTGACAATCCTGTACTTATGGGTTGGGATTATCCTAAGTGTGATCGTGCTATGCCAAACCTA CTACGTATTGTTAGTAGTTTGGTATTAGCCCGAAAACATGAGACATGTTGTTCGCAAAGCGATAGGTTTT ATCGACTTGCGAATGAATGCGCACAAGTTTTGAGTGAAATTGTTATGTGTGGTGGCTGTTATTATGTTAA GCCTGGTGGCACTAGTAGTGGTGATGCAACTACTGCTTTTGCTAATTCAGTCTTTAACATATGTCAAGCT GTTTCAGCCAATGTATGTGCCTTAATGTCATGCAATGGCAATAAGATTGAAGATCTTAGTATACGTGCTC TTCAGAAGCGCTTATACTCACATGTGTATAGAAGTGATAAGGTTGATTCAACCTTTGTCACAGAATATTA TGAATTTTTAAATAAGCATTTTAGTATGATGATTTTGAGTGATGATGGGGTTGTGTGTTATAATTCTGAT TATGCGTCCAAAGGGTATATTGCTAATATAAGTGCCTTTCAACAGGTATTATATTATCAAAATAACGTTT TTATGTCAGAATCCAAATGTTGGGTTGAACATGACATAAATAATGGACCTCATGAATTCTGTTCACAACA CACAATGCTTGTAAAGATGGATGGTGACGATGTCTACCTTCCATATCCTAATCCTAGTCGTATATTAGGA GCTGGATGTTTTGTAGATGATTTGTTAAAGACTGATAGTGTTCTTTTAATAGAACGATTTGTAAGTCTTG CAATAGATGCTTATCCACTTGTGTATCATGAAAATGAAGAATACCAAAAGGTTTTTCGTGTTTATTTGGC GTATATAAAGAAGTTGTACAATGACCTGGGTAATCAGATCTTGGATAGCTACAGTGTTATTTTAAGTACT TGTGATGGACAAAAGTTCACTGATGAGTCCTTTTACAAGAACATGTATTTAAGAAGTGCAGTTATGCAGA GTGTTGGAGCTTGCGTGGTCTGCTCTTCTCAAACATCATTACGTTGTGGCAGTTGCATCAGAAAGCCTCT TCTTTGCTGCAAGTGTTGTTATGATCATGTTATGGCGACTGATCATAAATATGTCTTGAGTGTTTCACCA TATGTGTGTAATGCACCAGGATGTGATGTAAATGATGTTACCAAATTGTATCTAGGTGGTATGTCATATT ATTGTGAAGACCATAAGCCACAATATTCATTCAAGTTGGTAATGAATGGTCTGGTTTTTGGTCTATATAA ACAATCTTGTACAGGATCTCCGTACATAGACGATTTTAATCGTATAGCTAGTTGTAAATGGACCGATGTG GATGATTACATACTAGCTAATGAATGTACAGAGCGCTTGAAATTGTTTGCTGCAGAAACGCAAAAGGCAA CCGAGGAAGCCTTTAAGCAGAGTTATGCATCAGCAACAATACAAGAGATTGTTAGTGAGCGCGAATTGAT TCTCTCTTGGGAGATTGGAAAAGTTAAGCCACCACTTAATAAAAATTATGTTTTTACTGGCTACCATTTT ACTAAAAATGGTAAGACAGTTTTAGGTGAGTATGTTTTTGATAAGAGTGAGTTGACTAATGGTGTGTATT ATCGCGCCACAACCACTTATAAGCTATCTGTAGGAGATGTTTTTGTTTTAACCTCTCATTCAGTAGCTAA TTTAAGTGCTCCTACGCTTGTTCCGCAGGAGAATTATAGTAGTATTAGATTTGCTAGTGTTTATAGTGTG CTTGAGACGTTTCAGAACAATGTTGTTAATTATCAACACATTGGTATGAAACGTTACTGCACCGTGCAAG GACCTCCTGGTACAGGGAAGTCACATCTTGCTATTGGTCTTGCTGTATTCTATTGTACAGCACGTGTTGT ATACACAGCGGCCAGCCATGCAGCTGTTGACGCATTGTGTGAAAAAGCATATAAATTTTTGAATATAAAT GATTGCACTCGTATTGTTCCGGCCAAGGTCAGGGTGGAGTGCTATGATAAGTTTAAAATTAATGACACCA CTCGTAAGTATGTGTTTACTACCATAAATGCATTACCTGAGATGGTGACTGATATTGTTGTTGTAGATGA AGTTAGTATGCTTACCAATTATGAGCTTTCTGTTATTAATGCTCGTATTCGCGCTAAGCATTATGTTTAT ATTGGTGATCCTGCTCAATTGCCAGCACCACGTGTGTTATTGAGCAAGGGTACACTTGAACCTAAATATT TTAACACTGTTACTAAGCTCATGTGTTGCTTAGGGCCAGACATTTTTCTTGGTACATGTTATAGATGTCC TAAGGAAATCGTTGATACAGTGTCCGCCTTGGTTTATGAAAATAAGCTTAAGGCTAAGAATGAGAGTAGT TCATTGTGTTTTAAGGTCTATTATAAGGGCGTTACAACACATGAAAGTTCTAGTGCTGTAAATATGCAGC AGATTTATTTGATTAATAAGTTTTTGAAGGCTAACCCTTTGTGGCATAAAGCTGTTTTTATTAGCCCATA TAATAGTCAGAACTTTGCAGCTAAGCGTGTTTTGGGTTTACAAACCCAAACCGTGGATTCTGCTCAAGGT TCTGAATATGATTATGTTATATATTCACAGACTGCAGAAACAGCGCATTCTGTAAATGTTAATCGCTTCA ATGTTGCTATTACTCGAGCCAAGAAAGGTATTCTTTGTGTTATGAGTAATATGCAGTTGTTTGAAGCATT ACAGTTTACTACATTGACCTTAGATAAAGTGCCACAGGCCGTCGAAACTAAAGTTCAATGTAGTACTAAT TTATTTAAAGATTGTAGCAAGAGTTATAGCGGTTATCACCCAGCTCATGCTCCTTCATTTTTGGCAGTAG ATGACAAATATAAGGCAACTGGCGATTTAGCCGTGTGTCTTGGTATTGGTGATTCTGCTGTTACATATTC AAGATTAATATCACTCATGGGTTTTAAATTGGATGTTACCCTTGATGGGTATTGTAAGCTTTTTATAACT AAAGAAGAAGCTGTTAAACGCGTGCGTGCCTGGGTTGGCTTTGATGCTGAAGGTGCTCATGCCACGCGTG ATAGCATTGGGACAAATTTCCCACTTCAATTAGGATTTTCCACAGGAATTGATTTTGTTGTGGAAGCCAC TGGTTTGTTTGCTGATAGAGATGGTTACAGCTTTAAAAAGGCTGTGGCGAAAGCTCCTCCTGGTGAACAA TTTAAGCACCTCATCCCTTTGATGACGAGAGGTCATCGCTGGGATGTTGTTAGACCTAGAATAGTACAAA TGTTTGCAGATCATTTAATTGATCTGTCTGATTGTGTTGTGCTAGTTACATGGGCAGCCAACTTTGAGCT CACTTGTCTCCGCTACTTTGCAAAAGTAGGGCGTGAGATTTCTTGTAATGTATGCACTAAACGTGCCACA GTTTACAATTCTAGAACTGGTTACTATGGTTGTTGGCGCCATAGTGTTACATGTGATTACTTGTATAATC CACTTATTGTTGATATTCAACAGTGGGGATATATTGGTTCTTTATCAAGTAATCATGATTTATATTGTAG TGTCCATAAAGGAGCACATGTTGCTTCCTCTGATGCTATAATGACACGGTGTTTGGCCGTTTATGATTGC TTTTGCAATAATATTAATTGGAATGTGGAGTATCCCATCATTTCAAATGAGTTAAGTATTAATACCTCTT GTAGGGTCTTGCAGCGTGTGATTCTTAAAGCTGCCATGCTCTGCAACAGATATACTTTGTGTTATGATAT TGGCAACCCAAAAGCGATTGCCTGTGTCAAAGATTTTGATTTTAAGTTCTATGATGCCCAACCAATTGTT AAGTCTGTTAAGACTCTTTTGTATTCTTTTGAGGCACATAAGGACTCTTTTAAAGACGGTTTGTGTATGT TTTGGAACTGTAATGTGGATAAGTATCCACCGAATGCAGTTGTATGTAGATTTGACACTAGAGTGTTGAA TAATTTAAATCTTCCTGGCTGTAATGGAGGTAGTTTGTATGTTAATAAACATGCATTCCACACTAAACCC TTTGCTAGGGCAGCCTTTGAGCATTTGAAGCCTATGCCATTCTTCTATTATTCAGATACGCCTTGTGTGT ATATGGATGGCATGGATGCTAAGCAGGTTGATTATGTACCTTTGAAATCTGCCACGTGCATCACAAGATG CAATTTAGGTGGTGCAGTTTGTTTAAAACATGCTGAAGAGTATCGTGAGTACTTAGAGTCTTACAATACA GCTACTACAGCAGGTTTTACTTTTTGGGTCTATAAGACATTTGATTTTTATAATTTGTGGAATACGTTCA CCAAGCTACAAAGCTTGGAGAATGTTGTATATAATTTAGTCAAGACTGGTCATTATACAGGACAGGCTGG TGAAATGCCTTGTGCCATTATAAATGATAAAGTTGTGGCTAAGATCGATAAGGAGGATGTTGTCATTTTT ATTAATAATACAACATACCCTACTAATGTGGCCGTTGAATTATTTGCCAAGCGCAGTGTTCGACACCACC CAGAGCTTAAGCTCTTTAGAAATTTAAATATAGACGTGTGTTGGAAGCACGTCATTTGGGATTATGCTAG AGAAAGTATATTTTGCAGTAATACCTATGGTGTCTGCATGTATACAGATTTAAAGTTCATTGATAAATTG AATGTCCTTTTTGATGGTCGTGATAATGGTGCTCTTGAAGCTTTTAAACGTTCTAATAATGGCGTTTACA TTTCCACGACAAAAGTTAAGAGTCTTTCGATGATAAGAGGTCCACCGCGTGCTGAATTAAATGGCGTAGT GGTGGACAAGGTTGGAGACACTGATTGTGTGTTTTATTTTGCTGTGCGTAAAGAAGGTCAGGATGTCATC TTCAGCCAATTCGACAGCCTGGGAGTCAGCTCTAACCAGAGCCCACAAGGTAATCTGGGGAGTAATGGTA AACCCGGTAATGTCGGTGGTAATGATGCTCTGTCAATCTCTACTATCTTTACACAAAGCCGTGTTATTAG CTCTTTTACATGTCGTACTGATATGGAAAAAGATTTTATAGCTTTAGATCAAGATGTGTTTATTCAGAAG TATGGTTTGGAGGACTATGCCTTTGAACACATTGTTTATGGTAACTTCAACCAGAAGATTATTGGTGGTT TGCATTTGTTAATAGGCTTGTACCGAAGACAGCAAACTTCCAATCTGGTTGTTCAGGAGTTTGTTTCATA TGACTCCAGCATACACTCTTATTTTATCACTGACGAGAAGAGTGGTGGTAGTAAGAGTGTTTGCACTGTT ATAGATATTTTGTTGGATGATTTTGTGGCTCTTGTTAAGTCACTTAATCTTAATTGTGTGAGTAAGGTTG TTAATGTTAATGTTGATTTTAAAGATTTTCAGTTTATGCTTTGGTGTAACGATGAGAAAGTTATGACTTT CTATCCTCGTTTGCAAGCTGCATCTGACTGGAAGCCTGGTTATTCTATGCCTGTATTATATAAGTATTTG AATTCTCCAATGGAAAGAGTTAGTCTCTGGAATTATGGGAAGCCAGTTACTTTGCCTACAGGCTGTATGA TGAATGTTGCTAAGTATACTCAGTTATGTCAATATCTGAATACTACAACATTAGCTGTACCTGTTAATAT GCGAGTTTTGCATTTAGGTGCAGGTTCAGAAAAAGGAGTAGCACCGGGTTCTGCAGTTCTTAGGCAGTGG TTGCCTGCTGGTACTATTCTTGTAGATAACGATTTATACCCATTTGTTAGTGACAGTGTCGCTACATATT TTGGGGATTGTATAACTTTACCCTTTGATTGTCAATGGGATTTGATAATTTCTGATATGTATGACCCTAT TACTAAGAACATAGGGGAGTACAATGTGAGTAAAGATGGTTTCTTTACATACATTTGTCATATGATTCGA GACAAGTTAGCTCTGGGTGGCAGTGTTGCTATAAAAATAACAGAGTTTTCTTGGAATGCAGAATTATATA AGTTAATGGGGTATTTTGCATTTTGGACTGTGTTTTGCACAAATGCAAATGCTTCTTCTAGTGAAGGATT TTTAATTGGCATAAATTATTTGTGTAAGCCCAAGGTTGAGATAGATGGAAATGTTATGCATGCCAATTAT TTGTTTTGGAGAAATTCCACAGTTTGGAACGGGGGTGCTTATAGCCTGTTTGATATGGCTAAATTCCCGC TTAAGTTGGCTGGTACTGCCGTAATAAATTTAAGAGCAGACCAGATTAATGATATGGTTTATTCCCTTCT TGAAAAGGGTAAACTACTTATTAGAGATACAAATAAAGAAGTTTTCGTTGGTGACAGTTTGGTTAATGTA ATCTAAACTTTAAAAATGGCTGTCGCTTATGCAGACAAGCCTAATCATTTTATCAATTTTCCACTTACCC ATTTTCAGGGTTTTGTGTTAAATTATAAAGGTTTACAATTTCAAATTCTCGATGAAGGAGTGGATTGTAA AATACAAACAGCGCCACACATTAGTCTTACTATGCTGGACATACAGCCTGAAGACTATAAAAGTGTTGAT GTCGCTATTCAAGAAGTTATTGATGATATGCATTGGGGTGATGGTTTTCAGATTAAATTTGAGAATCCTC ACATCCTAGGAAGATGCATAGTTTTAGATGTTAAAGGTGTAGAAGAATTGCATGACGATTTAGTTAATTA CATTCGTGATAAAGGTTGTGTTGCTGACCAATCCAGGAAATGGATTGGCCATTGCACCATAGCTCAACTC ACGGATGCAGCACTGTCCATTAAGGAAAATGTTGATTTTATAAACAGCATGCAATTCAATTATAAAATCA CCATCAACCCCTCATCACCGGCTAGACTTGAAATAGTTAAGCTCGGTGCTGAAAAGAAAGATGGTTTTTA TGAAACCATAGTTAGTCACTGGATGGGAATTCGTTTTGAATACACATCACCCACTGATAAGCTAGCTATG ATTATGGGTTATTGTTGTTTAGATGTGGTACGTAAAGAGCTAGAAGAAGGCGATCTTCCCGAGAATGATG ATGATGCTTGGTTTAAGCTATCGTACCATTATGAAAACAATTCTTGGTTCTTCCGACATGTCTACAGGAA AAGTTTTCATTTCCGTAAGGCTTGTCAAAATTTAGATTGTAATTGTTTGGGGTTTTATGAATCTTCAGTT GAAGAATATTAAACTCAGTGAAAATGTTTTTGCTTCCTAGATTTATTCTAGTTAGCTGCATAATTGGTAG CTTAGGTTTTTACAACCCTCCTACCAATGTTGTTTCGCATGTAAATGGAGATTGGTTTTTATTTGGTGAC AGTCGTTCAGATTGTAATCATATTGTTAATATCAACCCCCATAATTATTCTTATATGGACCTTAATCCTG TTCTGTGTGATTCTGGTAAAATATCATCTAAAGCTGGCAACTCCATTTTTAGGAGTTTTCACTTTACCGA TTTTTATAATTACACAGGCGAAGGTCAACAAATTATTTTTTATGAGGGTGTTAATTTTACGCCTTATCAT GCCTTTAAATGCAACCGTTCTGGTAGTAATGATATTTGGATGCAGAATAAAGGCTTGTTTTATACTCAGG TTTATAAGAATATGGCTGTGTATCGCAGCCTTACTTTTGTTAATGTACCATATGTTTATAATGGCTCCGC ACAAGCTACAGCTCTTTGTAAATCTGGTAGTTTAGTCCTTAATAACCCTGCATATATAGCTCCTCAAGCT AACTCTGGGGATTATTATTATAAGGTTGAAGCTGATTTTTATTTGTCAGGTTGTGACGAGTATATCGTAC CACTTTGTATTTTTAACGGCAAGTTTTTGTCGAATACAAAGTATTATGATGATAGTCAATATTATTTTAA TAAAGACACTGGTGTTATTTATGGTCTCAATTCTACAGAAACCATTACCACTGGTTTTGATCTTAATTGT TATTATTTAGTTTTACCCTCTGGTAATTATTTAGCCATTTCAAATGAGCTATTGTTAACTGTTCCTACGA AAGCAATCTGTCTTAATAAGCGTAAGGATTTTACGCCTGTACAGGTTGTTGATTCGCGGTGGAACAATGC CAGGCAGTCTGATAACATGACGGCGGTTGCTTGTCAACCTCCGTACTGTTATTTTCGTAATTCTACTACC AACTATGTTGGTGTTTATGATATTAATCATGGAGATGCTGGTTTTACTAGCATACTTAGTGGTTTGTTAT ATAATTCACCTTGTTTTTCGCAGCAAGGCGTTTTTAGGTATGATAATGTTAGCAGTGTCTGGCCTCTCTA CCCCTATGGCAGATGTCCCACTGCTGCTGATATTAATATCCCTGATTTACCCATTTGTGTGTATGATCCG CTACCAGTTATTTTGCTTGGCATTCTTTTGGGCGTTGCGATTGTAATTATTGTAGTTTTGTTGTTATATT TTATGGTGGATAATGTTACTAGGCTGCATGATGCTTAGACCATAATCTAAACATGTTTTTGATACTTTTA ATTTCCTTACCAACGGCTTTTGCTGTTATAGGAGATTTAAAGTGTACTTCAGATAATATTAATGATAAAG ACACCGGTCCTCCTCCTATAAGTACTGATACTGTTGATGTTACTAATGGTTTGGGTACTTATTATGTTTT AGATCGTGTGTATTTAAATACTACGTTGTTTCTTAATGGTTATTACCCTACTTCAGGTTCCACATATCGT AATATGGCACTGAAGGGAAGTGTACTATTGAGCAGACTATGGTTTAAACCACCATTTCTTTCTGATTTTA TTAATGGTATTTTTGCTAAGGTCAAAAATACCAAGGTTATTAAAGATCGTGTAATGTATAGTGAGTTCCC TGCTATAACTATAGGTAGTACTTTTGTAAATACATCCTATAGTGTGGTAGTACAACCACGTACAATCAAT TCAACACAGGATGGTGATAATAAATTACAAGGTCTTTTAGAGGTCTCTGTTTGCCAGTATAATATGTGCG AGTACCCACAAACGATTTGTCATCCTAACCTGGGTAATCATCGCAAAGAACTATGGCATTTGGATACAGG TGTTGTTTCCTGTTTATATAAGCGTAATTTCACATATGATGTGAATGCTGATTATTTGTATTTTCATTTT TATCAAGAAGGTGGTACTTTTTATGCATATTTTACAGACACTGGTGTTGTTACTAAGTTTTTGTTTAATG TTTATTTAGGCATGGCGCTTTCACACTATTATGTCATGCCTCTGACTTGTAATAGTAAGCTTACTTTAGA ATATTGGGTTACACCTCTCACTTCTAGACAATATTTACTCGCTTTCAATCAAGATGGTATTATTTTTAAT GCTGTTGATTGTATGAGTGATTTTATGAGTGAGATTAAGTGTAAAACACAATCTATAGCACCACCTACTG GTGTTTATGAATTAAACGGTTACACTGTTCAGCCAATCGCAGATGTTTACCGACGTAAACCTAATCTTCC CAATTGCAATATAGAAGCTTGGCTTAATGATAAGTCGGTGCCCTCTCCATTAAATTGGGAACGTAAGACA TTTTCAAATTGTAATTTTAATATGAGCAGCCTGATGTCTTTTATTCAGGCAGACTCATTTACTTGTAATA ATATTGATGCTGCTAAGATATATGGTATGTGTTTTTCCAGCATAACTATAGATAAGTTTGCTATACCCAA TGGCAGGAAGGTTGACCTACAATTGGGTAATTTGGGCTATTTGCAGTCATTTAACTATAGAATTGATACT ACTGCAACAAGTTGTCAGTTGTATTATAATTTACCTGCTGCTAATGTTTCTGTTAGCAGGTTTAATCCTT CTACTTGGAATAAGAGATTTGGTTTTATAGAAGATTCTGTTTTTAAGCCTCGACCTGCAGGTGTTCTTAC TAATCATGATGTAGTTTATGCACAACACTGTTTCAAAGCTCCTAAAAATTTCTGTCCGTGTAAATTGAAT GGTTCGTGTGTAGGTAGTGGTCCTGGTAAAAATAATGGTATAGGCACTTGTCCTGCAGGTACTAATTATT TAACTTGTGATAATTTGTGCACTCCTGATCCTATTACATTTACAGGTACTTATAAGTGCCCCCAAACTAA ATCTTTAGTTGGCATAGGTGAGCACTGTTCGGGTCTTGCTGTTAAAAGTGATTATTGTGGAGGCAATTCT TGTACTTGCCGACCACAAGCATTTTTGGGTTGGTCTGCAGACTCTTGTTTACAAGGAGACAAGTGTAATA TTTTTGCTAATTTTATTTTGCATGATGTTAATAGTGGTCTTACTTGTTCTACTGATTTACAAAAAGCTAA CACAGACATAATTCTTGGTGTTTGTGTTAATTATGACCTCTATGGTATTTTAGGCCAAGGCATTTTTGTT GAGGTTAATGCGACTTATTATAATAGTTGGCAGAACCTTTTATATGATTCTAATGGTAATCTCTACGGTT TTAGAGACTACATAACAAACAGAACTTTTATGATTCGTAGTTGCTATAGCGGTCGTGTTTCTGCGGCCTT TCACGCTAACTCTTCCGAACCAGCATTGCTATTTCGGAATATTAAATGCAACTACGTTTTTAATAATAGT CTTACACGACAGCTGCAACCCATTAACTATTTTGATAGTTATCTTGGTTGTGTTGTCAATGCTTATAATA GTACTGCTATTTCTGTTCAAACATGTGATCTCACAGTAGGTAGTGGTTACTGTGTGGATTACTCTAAAAA CAGACGAAGTCGTGGAGCGATTACCACTGGTTATCGGTTTACTAATTTTGAGCCATTTACTGTTAATTCA GTAAACGATAGTTTAGAACCTGTAGGTGGTTTGTATGAAATTCAAATACCTTCAGAGTTTACTATAGGTA ATATGGTGGAGTTTATTCAAACAAGCTCTCCTAAAGTTACTATTGATTGTGCTGCATTTGTCTGTGGTGA TTATGCAGCATGTAAATCACAGTTGGTTGAATATGGTAGTTTCTGTGATAACATTAATGCCATACTCACA GAAGTAAATGAACTACTTGACACTACACAGTTGCAAGTAGCTAATAGTTTAATGAATGGTGTTACTCTTA GCACTAAGCTTAAAGATGGCGTTAATTTCAATGTAGACGACATCAATTTTTCCCCTGTATTAGGTTGTCT AGGCAGCGAATGTAGTAAAGCTTCCAGTAGATCTGCTATAGAGGATTTACTTTTTGATAAAGTAAAGTTA TCTGATGTCGGTTTTGTTGAGGCTTATAATAATTGTACAGGAGGTGCCGAAATTAGGGACCTCATTTGTG TGCAAAGTTATAAAGGCATCAAAGTGTTGCCTCCACTGCTCTCAGAAAATCAGATCAGTGGATACACTTT GGCTGCCACCTCTGCTAGTCTATTTCCTCCTTGGACAGCAGCAGCAGGTGTACCATTTTATTTAAATGTT CAGTATCGCATTAATGGGCTTGGTGTCACCATGGATGTGCTAAGTCAAAATCAAAAGCTTATTGCTAATG CATTTAACAATGCCCTTTATGCTATTCAGGAAGGGTTCGATGCAACTAATTCTGCTTTAGTTAAAATTCA AGCTGTTGTTAATGCAAATGCTGAAGCTCTTAATAACTTATTGCAACAACTCTCTAATAGATTTGGTGCT ATAAGTGCTTCTTTACAAGAAATTCTATCTAGACTTGATGCTCTTGAAGCGGAAGCTCAGATAGATAGAC TTATTAATGGTCGTCTTACCGCTCTTAATGCTTATGTTTCTCAACAGCTTAGTGATTCTACACTGGTAAA ATTTAGTGCAGCACAAGCTATGGAGAAGGTTAATGAATGTGTCAAAAGCCAATCATCTAGGATAAATTTC TGTGGTAATGGTAATCATATTATATCATTAGTGCAGAATGCTCCATATGGTTTGTATTTTATCCACTTTA GTTATGTCCCTACTAAGTATGTCACAGCGAGGGTTAGTCCTGGTCTGTGCATTGCTGGTGATAGAGGTAT AGCTCCTAAGAGTGGTTATTTTGTTAATGTAAATAATACTTGGATGTACACTGGTAGTGGTTACTACTAC CCTGAACCTATAACTGAAAATAATGTTGTTGTTATGAGTACCTGCGCTGTTAATTATACTAAAGCGCCGT ATGTAATGCTGAACACTTCAATACCCAACCTTCCTGATTTTAAGGAAGAGTTGGATCAATGGTTTAAAAA TCAAACATCAGTGGCACCAGATTTGTCACTTGATTATATAAATGTTACATTCTTGGACCTACAAGTTGAA ATGAATAGGTTACAGGAGGCAATAAAAGTCTTAAATCAGAGCTACATCAATCTCAAGGACATTGGTACAT ATGAATATTATGTAAAATGGCCTTGGTATGTATGGCTTTTAATCTGCCTTGCTGGTGTAGCTATGCTTGT TTTACTATTCTTCATATGCTGTTGTACAGGATGTGGGACTAGTTGTTTTAAGAAATGTGGTGGTTGTTGT GATGATTATACTGGATACCAGGAGTTAGTAATCAAAACTTCACATGACGACTAAGTTCGTCTTTGATTCA TTGCACTGATCTCTTGTTAGATCTTTTTGCAATCTAGCATTTGTTAAAGTTCTTAAGGCCACGCCCTATT AATGGACATTTGGAGACCTGAGAAGAAATATCTCCGTTATATTAACGGTTTTAATGTCTCAGAATTAGAA GATGCTTGTTTTAAATTTAACTATCAATTTCCTAAAGTAGGATATTGTAGAGTTCCTAGTCATGCTTGGT GCCGTAATCAAGGTAGATTTTGTGCTACATTCACTCTTTATGGTAAATCCAAACATTATGATAAATATTT TGGAGTAATAAATGGTTTCACAGCATTCGCTAATACTGTAGAGGATGCTGTTAACAAACTGGTTTTCTTA GCTGTTGACTTTATTACCTGGCGCAGACAGGAGTTAAATGTTTATGGCTGATGCTTATCTTGCAGACACT GTGTGGTATGTGGGGCAAATAATTTTTATAGTTGCCATTTGTTTATTGGTTACAATAGTTGTAGTGGCAT TTTTGGCAACTTTTAAATTGTGTATTCAACTTTGCGGTATGTGTAATACCTTAGTACTGTCCCCTTCTAT TTATGTGTTTAATAGAGGTAGGCAGTTTTATGAGTTTTACAATGATGTAAAACCACCAGTCCTTGATGTG GATGACGTTTAGGTAATCCAAACATTATGAGTAGTAAAACTACACCAGCACCAGTTTATATCTGGACTGC TGATGAAGCTATTAAATTCCTAAAGGAATGGAATTTTTCTTTGGGTATTATACTACTTTTTATTACAATC ATATTGCAATTTGGATATACAAGTCGCAGTATGTTTGTTTATGTTATTAAGATGATTATTTTGTGGCTTA TGTGGCCCCTTACTATAATCTTAACTATTTTCAATTGCGTATACGCATTGAATAATGTGTATCTTGGCCT TTCTATAGTTTTTACCATAGTGGCCATTATTATGTGGATTGTGTATTTTGTGAATAGTATCAGGTTGTTT ATTAGAACTGGAAGTTTTTGGAGTTTCAACCCAGAAACAAACAACTTGATGTGTATAGATATGAAAGGAA CAATGTATGTTAGGCCGATAATTGAGGACTATCATACTCTGACGGTCACAATAATACGCGGCCATCTTTA CATTCAAGGTATAAAACTAGGTACTGGCTATTCTTTGGCAGATTTGCCAGCTTATATGACTGTTGCTAAG GTTACACACCTGTGCACATATAAGCGTGGTTTTCTTGACAGGATAAGCGATACTAGTGGTTTTGCTGTTT ATGTTAAGTCCAAAGTCGGTAATTACCGACTGCCATCAACCCAAAAGGGTTCTGGCATGGACACCGCATT GTTGAGAAATAATATCTAAATTTTAAGGATGTCTTTTACTCCTGGTAAGCAATCCAGTAGTAGAGCGTCC TCTGGAAATCGTTCTGGTAATGGCATCCTCAAGTGGGCCGATCAGTCCGACCAGTTTAGAAATGTTCAAA CCAGGGGTAGAAGAGCTCAACCCAAGCAAACTGCTACCTCTCAGCAACCATCAGGAGGGAATGTTGTACC CTACTATTCTTGGTTCTCTGGAATTACTCAGTTTCAAAAGGGAAAGGAGTTTGAGTTTGTAGAAGGACAA GGTGTGCCTATTGCACCAGGAGTCCCAGCTACTGAAGCTAAGGGGTACTGGTACAGACACAACAGACGTT CTTTTAAAACAGCCGATGGCAACCAGCGTCAACTGCTGCCACGATGGTATTTTTACTATCTGGGAACAGG ACCGCATGCTAAAGACCAGTACGGCACCGATATTGACGGAGTCTACTGGGTCGCTAGCAACCAGGCTGAT GTCAATACCCCGGCTGACATTGTCGATCGGGACCCAAGTAGCGATGAGGCTATTCCGACTAGGTTTCCGC CTGGCACGGTACTCCCTCAGGGTTACTATATTGAAGGCTCAGGAAGGTCTGCTCCTAATTCCAGATCTAC TTCGCGCACATCCAGCAGAGCCTCTAGTGCAGGATCGCGTAGTAGAGCCAATTCTGGCAATAGAACCCCT ACCTCTGGTGTAACACCTGACATGGCTGATCAAATTGCTAGTCTTGTTCTGGCAAAACTTGGCAAGGATG CCACTAAACCTCAGCAAGTAACTAAGCATACTGCCAAAGAAGTCAGACAGAAAATTTTGAATAAGCCCCG CCAGAAGAGGAGCCCCAATAAACAATGCACTGTTCAGCAGTGTTTTGGTAAGAGAGGCCCTAATCAGAAT TTTGGTGGTGGAGAAATGTTAAAACTTGGAACTAGTGACCCACAGTTCCCCATTCTTGCAGAACTCGCAC CCACAGCTGGTGCGTTTTTCTTTGGATCAAGATTAGAGTTGGCCAAAGTGCAGAATTTATCTGGGAATCC TGACGAGCCCCAGAAGGATGTTTATGAATTGCGCTATAACGGCGCAATTAGGTTTGACAGTACACTTTCA GGTTTTGAGACCATAATGAAGGTGCTGAATGAGAATTTGAATGCCTATCAACAACAAGATGGTATGATGA ATATGAGTCCAAAACCACAGCGTCAGCGTGGTCATAAGAATGGACAAGGAGAAAATGATAATATAAGTGT TGCAGTGCCCAAAAGCCGCGTGCAGCAAAATAAGAGTAGAGAGTTGACTGCAGAGGACATCAGCCTTCTT AAGAAGATGGATGAGCCCTATACTGAAGACACCTCAGAAATATAAGAGAATGAACCTTATGTCGGCATCT GGTGGTAACCCCTCGCAGAAAAGTCGAGATAAGGCACTCTCTATCAGAATGGATGTCTTGCTGCTATAAT AGATAGAGAAGGTTATAGCAGACTATAGATTAATTAGTTGAAAGTTTTGTGTTGTAATGTATAGTGTTGG AGAAAGTGAAAGACTTGCGGAAGTAATTGCCGACAAGTGCCCAAGGGAAGAGCCAGCATGTTAAGTTACC ACCCAGTAATTAGTAAATGAATGAAGTTAATTATGGCCAATTGGAAGAATCACAAAAAAAAAAAAAAAAA AAAAAAAAAAA Click to Show/Hide
|
|---|

