Details of Virus RNA

 Virus RNA General Information
  Strain Information Strain Name
hCov-OC43/VR-759 Quebec/2019
Strain Family
Beta
RNA Binding Site
Not Specified Virus Region
  Virus Information Virus Name
Human coronavirus OC43 (HCov-OC43)
Taxonomy ID 31631
GeneBank ID NC_006213

Virus RNA - Host Protein Network
  Regulation Network
  Network Download  
  Full list of proteins interacting with the Not Specified Virus Region of this Strain
           APOBEC1-binding protein 1 (HNRNPAB)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Polyadenylate-binding protein 1 (PABPC1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Heterogeneous nuclear ribonucleoprotein L (LGALS4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Heterogeneous nuclear ribonucleoprotein U (HNRNPU)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           40S ribosomal protein S7 (RPS6)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           ELAV-like protein 1 (ELAVL1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           NonO protein (NONO)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           140 kDa nucleolar phosphoprotein (Nopp140)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           28S ribosomal protein S5 (S5mt)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           28S ribosomal protein S7 (MRP-S7)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           30 kDa splicing factor SMNrp (SMNDC1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           39S ribosomal protein L11 (L11mt)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           39S ribosomal protein L13 (MRP-L13)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           39S ribosomal protein L2 (MRP-L2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           39S ribosomal protein L27 (L27mt)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           39S ribosomal protein L28 (MRP-L28)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           39S ribosomal protein L37 (L2mt)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           39S ribosomal protein L43 (L43mt)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           39S ribosomal protein L44 (MRP-L44)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           39S ribosomal protein S18a (Mrps18a)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           40S ribosomal protein S14 (RPS11)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           40S ribosomal protein S14 (RPS11)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           40S ribosomal protein S15 (RPS14)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           40S ribosomal protein S18 (H4C1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           40S ribosomal protein S20 (RPS2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           40S ribosomal protein S3a (RPS3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           40S ribosomal protein S4, X isoform (RPS3A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           40S ribosomal protein S5 (RPS4X)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           40S ribosomal protein S6 (RPS5)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           5'-3' exoribonuclease 1 (ACACA)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L17 (RPL14)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L18 (H3-2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L19 (RPL18A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L22 (RPL21)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L26 (RPL24)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L27 (RPL26)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L29 (RPL28)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L3 (RPL29)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L30 (RPL3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L31 (RPL30)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L34 (RPL31)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L35a (RPL35)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S ribosomal protein L6 (RPL5)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Ataxin-2-like protein (A2RP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           ATP-binding cassette 50 (ABC50)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           AU-rich element RNA-binding protein 1 (AUF1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Bcl-2-associated transcription factor 1 (Btf)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           BUD13 homolog (BUD13)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Cellular nucleic acid-binding protein (CNBP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Cold shock domain-containing protein E1 (CSDE1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           CPE-binding protein 4 (hCPEB-4)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           CUGBP Elav-like family member 1 (CELF1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           DAZ-associated protein 1 (DAZAP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           DEAD box protein 24 (DDX24)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           DEAD box protein 51 (DDX51)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           DEAD box protein 52 (MRM1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           DEAD box protein 55 (KIAA1595)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           DEAD box protein 6 (DDX6)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           DEAH box protein 30 (KIAA0890)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           DEAH box protein 30 (KIAA0890)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           DiGeorge syndrome critical region 8 (DGCR8)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           DNA dC->dU-editing enzyme APOBEC-3C (A3C)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           DNA repair protein XRCC6 (XRCC6)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           DNA-directed RNA polymerase II RPB7 (hsRPB7)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Double-stranded RNA-binding protein Staufen homolog 2 (STAU2)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           E1B-55 kDa-associated protein 5 (E1B-AP5)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           E2-induced gene 3 protein (GNL3)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           E3 ubiquitin/ISG15 ligase TRIM25 (TRIM25)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           EBNA2 coactivator p100 (SND1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           eIF-3-theta (EIF3A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Eukaryotic translation initiation factor 3 subunit C (EIF3C)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Eukaryotic translation initiation factor 3 subunit D (EIF3D)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Eukaryotic translation initiation factor 3 subunit D (EIF3D)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Eukaryotic translation initiation factor 3 subunit G (EIF3G)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Eukaryotic translation initiation factor 3 subunit H (EIF3H)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Eukaryotic translation initiation factor 4B (EIF4B)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Eukaryotic translation initiation factor 4H (EIF4H)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Exosome complex component RRP46 (EXOSC5)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           FAST kinase domain-containing protein 2 (FASTKD2)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           FAST kinase domain-containing protein 4 (TBRG4)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           GAP SH3 domain-binding protein 1 (G3BP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           GAP SH3 domain-binding protein 2 (G3BP2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           GAP-associated tyrosine phosphoprotein p62 (KHDRBS1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Gem-associated protein 5 (GEMIN5)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Glutamate-rich WD repeat-containing protein 1 (GRWD1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Helicase A-binding protein 95 (HAP95)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Helicase MOV-10 (MOV10)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Helicase-like protein 2 (HLP2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Helicase-like transcription factor (HLTF)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Heterogeneous nuclear ribonucleoprotein H3 (HNRNPH3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Heterogeneous nuclear ribonucleoprotein M (HNRNPM)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           hFXR2p (FXR2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Histone RNA hairpin-binding protein (SLBP)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           HUMAN la-related protein 1 (LARP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           IF-4-gamma 1 (EIF4G1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           IGF2-binding protein 2 (IMP-2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           IGF2-binding protein 3 (IMP-3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Interferon-regulated antiviral protein (IRAV)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24 h
              Infection Cells Vero cells (epithelial kidney cell)  (CVCL_0059 )
              Cell Originated Tissue kidney
              Interaction Score adj. p_value < 0.05
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Interleukin enhancer-binding factor 2 (ILF2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Interleukin enhancer-binding factor 3 (ILF3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           La-related protein 4 (LARP4)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           La-related protein 7 (LARP7)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Leucine-rich repeat-containing protein 47 (LRRC47)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Lupus La protein (SSB)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Matrin-3 (MATR3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Methionine aminopeptidase 2 (METAP2)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Microtubule-associated protein 4 (MAP4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           NF-kappa-B-repressing factor (NKRF)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Nipped-B-like protein (NIPBL)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Nucleolar protein 12 (YWHAE)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Nucleolar RNA helicase 2 (DDX21)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Nucleolysin TIAR (TIAL1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Nucleophosmin (NPM1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Nucleophosmin (NPM1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Oxidative stress-associated Src activator (OSSA)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           P21- and CDK-associated protein 1 (TOK1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           PAI1 RNA-binding protein 1 (PAI-RBP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           PAI1 RNA-binding protein 1 (PAI-RBP1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Paraspeckle component 1 (PSPC1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Peptidyl-prolyl cis-trans isomerase G (PPIG)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Peptidyl-prolyl cis-trans isomerase-like 4 (PPIL4)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           PHD finger protein 6 (PHF6)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Poly [ADP-ribose] polymerase 12 (PARP12)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Poly(A) RNA polymerase
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Poly(rC)-binding protein 1
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Polyadenylate-binding protein 2 (PABPN1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Polyadenylate-binding protein 4 (PABPC4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Polyadenylate-binding protein 4 (PABPC4)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Polypyrimidine tract-binding protein 3 (PTBP3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Positive cofactor 4 (PC4)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           PP-1B (HNRNPUL2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Pre-mRNA-processing factor 17 (CDC40)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Protein FAM98A (FAM98A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Protein kinase A-anchoring protein 1 (PRKA1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Protein kinase C inhibitor protein 1 (KCIP-1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Protein lin-28 homolog B (LIN28B)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Protein quaking (QKI)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Protein SDA1 homolog (SDAD1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Pseudouridylate synthase 1 homolog (PUS1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Pumilio homolog 1 (PUM1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Pumilio homolog 1 (PUM1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Pumilio homolog 2 (PUM2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Ran-binding protein 21 (XPO5)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Regulator of nonsense transcripts 1 (NORF1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Ribonuclease 3 (DROSHA)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Ribosome maturation protein SBDS (SBDS)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           RNA binding protein fox-1 homolog 2 (RPS17)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           RNA helicase-related protein (RNAHP)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           RNA pseudouridylate synthase domain-containing (RPUSD3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           RNA-binding protein 15 (RBM15)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           RNA-binding protein 3 (RBM3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           RNA-binding protein 47 (RBM47)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           RNA-binding protein 5 (G15)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           RNA-binding protein EWS (EWSR1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           RNA-binding protein FUS (FUS)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           RNA-binding protein Raly (RALY)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           SAFB-like transcription modulator (SLTM)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Scaffold attachment factor B1 (SAFB)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Scaffold attachment factor B2 (SAFB2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Sequestosome-1 p62 (SQSTM1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           SNU114 homolog (hSNU114)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Spinocerebellar ataxia type 2 protein (SCA2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Spliceosome-associated protein 155 (SF3B1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           splicing factor (PSF)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           splicing factor (PSF)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Splicing factor U2AF 35 kDa subunit (U2AF1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Substrate of AIM1/Aurora kinase B (NSUN2)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Suppressor of var1 3-like protein 1 (SUV3)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Synaptic functional regulator FMR1 (FMR1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           T-cell-restricted intracellular antigen-1 (TIA-1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Thyroid hormone receptor-associated protein 3 (THRAP3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Transcriptional activator protein Pur-alpha (PURA)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Transformer-2 protein homolog alpha (TRA2A)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           TROVE domain family member 2 (TROVE2)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           U7 snRNA-associated Sm-like protein LSm11 (LSM11)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Ubiquitin C-terminal hydrolase UCH37 (UCHL5)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Ubiquitin-associated protein 2-like (UBAP2L)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           WD repeat-containing protein 3 (WDR3)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           WD repeat-containing protein 43 (WDR43)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           WD repeat-containing protein 50 (UTP18)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           WD splicing factor Prp4 (hPrp4)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Werner syndrome ATP-dependent helicase (WRN)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Y-box-binding protein 1 (YBX1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Y-box-binding protein 3 (YBX3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Zinc finger CCCH domain-containing protein 11A (ZC3H11A)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Zinc finger CCCH domain-containing protein 8 (ZC3H8)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Zinc finger CCCH-type antiviral protein 1 (ZC3HAV1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 12h; 24; 36h; 48h
              Infection Cells HCT-8 cells (Human ileocaecal adenocarcinoma cell)  (CVCL_2478 )
              Cell Originated Tissue Ileocecum
              Interaction Score p_value < 0.05; FDR < 10%
              Description of Detection Method Modified RNA antisense purification coupled with mass spectrometry (RAP-MS); label-free quantification (LFQ); liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Zinc finger protein 622 (ZNF622)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells K562 cells (Human leukemic cell line)  (CVCL_0004 )
              Cell Originated Tissue Bone marrow
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm

Virus RNA Sequence Information (Source: GeneBank)
>NC_006213.1 Human coronavirus OC43 strain ATCC VR-759, complete genome
ATTGTGAGCGATTTGCGTGCGTGCATCCCGCTTCACTGATCTCTTGTTAGATCTTTTTGTAATCTAAACT TTATAAAAACATCCACTCCCTGTAATCTATGCTTGTGGGCGTAGATTTTTCATAGTGGTGTTTATATTCA TTTCTGCTGTTAACAGCTTTCAGCCAGGGACGTGTTGTATCCTAGGCAGTGGCCCGCCCATAGGTCACAA TGTCGAAGATCAACAAATACGGTCTCGAACTACACTGGGCTCCAGAATTTCCATGGATGTTTGAGGACGC AGAGGAGAAGTTGGATAACCCTAGTAGTTCAGAGGTGGATATGATTTGCTCCACCACTGCGCAAAAGCTG GAAACAGACGGAATTTGTCCTGAAAATCATGTGATGGTGGATTGTCGCCGACTTCTTAAACAAGAGTGTT GTGTGCAGTCTAGCCTAATACGTGAAATTGTTATGAATGCAAGTCCATATGATTTGGAGGTGCTACTTCA AGATGCTTTGCAGTCCCGTGAAGCAGTTTTGGTTACAACCCCCTTAGGTATGTCTTTAGAGGCATGCTAT GTGAGAGGTTGTAATCCTAAAGGATGGACCATGGGTTTGTTTCGGCGTAGAAGTGTGTGTAACACTGGTC GTTGCACTGTTAATAAGCATGTGGCCTATCAGTTATATATGATTGATCCTGCAGGTGTCTGTCTTGGTGC AGGTCAATTCGTGGGTTGGGTCATACCCTTAGCCTTTATGCCTGTGCAATCCCGGAAATTTATTGTTCCA TGGGTTATGTACTTGCGTAAGCGTGGCGAAAAGGGTGCTTACAATAAAGATCATGGACGTGGCGGTTTTG GACATGTTTATGATTTTAAAGTTGAAGATGCTTATGACCAGGTGCATGATGAGCCTAAGGGTAAGTTTTC TAAGAAGGCTTATGCTTTAATTAGAGGGTATCGTGGTGTTAAACCACTTCTCTATGTAGACCAGTATGGT TGTGATTATACTGGTAGTCTTGCAGATGGCTTAGAGGCTTATGCTGATAAGACATTGCAAGAAATGAAGG CATTATTTCCTACTTGGAGTCAGGAACTCCTTTTTGATGTAATTGTGGCATGGCATGTTGTGCGTGATCC ACGTTATGTTATGAGATTGCAGAGTGCTGCTACTATACGTAGTGTTGCATATGTTGCTAATCCTACTGAA GACTTGTGTGATGGTTCTGTTGTTATAAAAGAACCTGTGCATGTTTATGCAGATGACTCTATTATTTTAC GTCAATATAATTTAGTTGACATTATGAGTCATTTTTATATGGAGGCAGATACAGTTGTAAATGCTTTTTA TGGTGTTGCTTTGAAAGATTGCGGTTTTGTTATGCAGTTTGGTTACATTGATTGCGAACAAGACTCGTGT GATTTTAAAGGTTGGATTCCTGGTAACATGATAGATGGTTTTGCTTGCACCACTTGTGGTCATGTTTATG AAGTAGGTGATTTGATGGCACAATCTTCAGGTGTTTTGCCTGTTAACCCTGTATTGCATACTAAGAGTGC AGCAGGCTATGGTGGTTTTGGTTGTAAAGATTCTTTTACTCTGTATGGCCAAACTGTAGTTTATTTTGGA GGTTGTGTGTATTGGAGTCCAGCACGTAATATATGGATTCCTATATTAAAATCCTCTGTTAAGTCATATG ACAGTTTGGTTTATACTGGAGTTTTAGGTTGCAAGGCTATTGTAAAGGAAACAAATCTCATTTGCAAAGC TTTGTACCTTGATTATGTTCAACACAAGTGTGGCAATTTACACCAACGGGAGTTGCTAGGTGTTTCAGAT GTGTGGCATAAACAATTGCTATTAAATAGAGGTGTTTATAAACCTCTGTTAGAGAATATTGATTATTTTA ATATGCGGCGCGCTAAATTTAGTTTAGAAACTTTTACTGTTTGTGCAGATGGCTTTATGCCTTTTCTTTT AGATGATTTAGTTCCACGCGCATATTATTTGGCAGTAAGTGGTCAAGCATTTTGTGATTATGCAGATAAA CTTTGCCATGCCGTTGTGTCTAAGAGTAAAGAGTTACTTGATGTGTCTCTGGATTCTTTAGGTGCAGCTA TACATTATTTGAATTCTAAGATTGTTGATTTGGCTCAACATTTTAGTGATTTTGGAACAAGTTTCGTTTC TAAAATTGTTCATTTCTTTAAGACTTTTACTACTAGCACTGCTCTTGCATTTGCATGGGTTTTATTTCAT GTTTTGCATGGTGCTTATATAGTAGTGGAGAGTGATATATATTTTGTTAAAAACATTCCTCGTTATGCTA GTGCTGTTGCACAAGCATTTCAGAGTGTTGCTAAAGTTGTACTGGACTCTTTAAGAGTTACTTTTATTGA TGGCCTTTCTTGTTTTAAGATTGGACGTAGAAGAATTTGTCTTTCAGGCAGAAAAATTTATGAAGTTGAG CGTGGCTTGTTACATTCATCCCAATTGCCATTAGATGTTTATGATTTAACCATGCCTAGTCAAGTTCAGA AAGCCAAGCAAAAACCTATTTATTTAAAAGGTTCTGGTTCTGATTTTTCATTAGCGGATAGTGTAGTTGA AGTTGTTACAACTTCACTTACACCATGTGGTTATTCTGAACCACCTAAAGTTGCAGCTAAAATTTGCATT GTGGATAATGTTTATATGGCCAAGGCTGGTGACAAATATTACCCTGTTGTGGTTGATGATCATGTTGGAC TCTTGGATCAAGCATGGAGAGTTCCTTGTGCTGGAAGGCGTGTTACATTTAAGGAACAGCCTACAGTAAA GGAGATTATAAGCATGCCTAAGATTATTAAGGTTTTTTATGAGCTTGACAACGATTTTAATACTATTTTA AATACTGCGTGTGGAGTGTTTGAAGTGGATGATACTGTTGATATGGAGGAATTTTATGCTGTGGTGATTG ATGCCATAGAAGAGAAACTTTCTCCATGTAAGGAGCTTGAAGGTGTAGGTGCTAAAGTTAGTGCCTTTTT ACAGAAATTAGAGGATAATCCCCTATTTTTATTTGATGAGGCTGGCGAGGAAGTTCTTGCTCCTAAATTG TATTGTGCCTTTACAGCTCCTGAAGATGATGACTTTCTTGAGGAAAGTGATGTTGAAGAAGATGATGTAG AAGGTGAGGAAACTGATTTAACTGTCACAAGTGCTGGACAGCCTTGTGTTGCTAGTGAACAGGAGGAGTC TTCTGAAGTCTTAGAGGACACTTTGGATGATGGTCCAAGTGTGGAGACATCTGATTCACAAGTTGAAGAA GATGTAGAAATGTCGGATTTTGTTGATCTTGAATCTGTGATTCAGGATTATGAAAATGTTTGTTTTGAGT TTTATACTACAGAGCCAGAATTTGTTAAAGTTTTGGGTCTGTATGTGCCTAAAGCAACTCGCAACAATTG CTGGTTGCGATCAGTTTTGGCAGTGATGCAGAAATTGCCCTGTCAATTTAAAGATAAAAATTTGCAGGAT CTTTGGGTGTTATACAAGCAACAGTATAGTCAGTTGTTTGTTGATACCTTGGTTAATAAGATACCTGCTA ATATTGTACTTCCACAAGGTGGTTATGTTGCTGATTTTGCATATTGGTTTTTAACCTTATGTGATTGGCA GTGTGTTGCATACTGGAAATGCATTAAATGTGATTTAGCTCTTAAGCTTAAAGGCTTGGATGCTATGTTC TTTTATGGTGATGTTGTTTCACATATATGCAAGTGTGGTGAGTCTATGGTACTTATTGATGTTGATGTGC CATTTACAGCCCACTTTGCTCTTAAAGATAAGTTGTTTTGTGCATTTATTACTAAGCGTATTGTGTATAA AGCAGCTTGTGTTGTGGATGTTAATGATAGTCATTCTATGGCTGTTGTTGATGGTAAACAAATTGATGAT CATCGTATCACTAGTATTACTAGTGATAAGTTTGATTTTATTATTGGGCATGGTATGTCATTTTCAATGA CTACTTTTGAAATTGCCCAATTGTATGGTTCTTGTATAACACCTAATGTGTGTTTTGTTAAAGGTGATAT AATTAAAGTATCTAAGCTTGTTAAAGCAGAAGTTGTTGTAAACCCTGCTAATGGCCATATGGCACATGGT GGTGGTGTTGCAAAAGCTATTGCAGTAGCAGCTGGACAGCAGTTTGTTAAAGAGACTACCGATATGGTTA AGTCTAAAGGAGTTTGTGCTACTGGAGATTGTTATGTCTCTACAGGGGGCAAATTATGTAAAACTGTGCT TAATGTTGTTGGACCTGATGCGAGAACACAGGGTAAACAAAGTTATGTATTGTTAGAGCGTGTTTATAAA CATCTTAACAACTATGACTGTGTTGTTACAACTTTGATCTCAGCTGGTATATTTAGTGTGCCTTCTGATG TGTCTTTAACATATCTACTTGGTACTGCTAAGAAACAAGTTGTTCTTGTTAGCAATAATCAAGAGGATTT TGATCTTATTTCTAAGTGTCAGATAACTGCTGTTGAGGGCACTAAGAAATTGGCAGCGCGTCTTTCTTTT AATGTTGGACGTTCCATTGTTTACGAAACAGATGCTAATAAGTTGATTTTAATCAATGACGTTGCATTTG TTTCGACATTTAATGTTTTACAGGATGTTTTATCCTTAAGACATGATATAGCACTTGATGATGATGCACG AACCTTCGTTCAGAGCAATGTTGATGTTGTACCTGAGGGTTGGCGTGTTGTCAATAAGTTTTATCAAATT AATGGTGTTAGAACCGTTAAGTATTTTGAGTGTACTGGAGGCATAGATATATGCAGCCAGGATAAAGTTT TTGGTTATGTACAGCAGGGTATTTTTAATAAGGCTACTGTTGCTCAAATTAAAGCCTTGTTTTTGGATAA AGTGGACATCTTGCTAACTGTTGATGGTGTTAATTTCACTAATAGGTTTGTGCCTGTTGGTGAAAGTTTT GGTAAGAGTCTAGGAAATGTGTTTTGTGATGGAGTTAATGTCACGAAGCATAAGTGTGATATAAATTATA AAGGTAAAGTCTTTTTCCAGTTTGATAATCTTTCTAGTGAAGATTTAAAGGCTGTAAGAAGTTCCTTTAA TTTTGATCAGAAGGAATTGCTTGCCTATTACAACATGCTTGTTAATTGTTTTAAGTGGCAGGTTGTTGTT AATGGTAAGTATTTCACTTTTAAGCAAGCTAATAACAATTGTTTTGTTAATGTTTCTTGCTTAATGCTCC AGAGTTTGCATCTGACATTTAAAATTGTTCAATGGCAAGAGGCATGGCTTGAATTTCGTTCTGGCCGCCC TGCTAGATTTGTAGCTTTGGTTTTGGCCAAAGGTGGGTTTAAATTTGGAGATCCTGCTGATTCTAGAGAT TTCTTGCGTGTTGTGTTTAGTCAAGTTGATTTGACTGGGGCAATATGTGATTTTGAAATTGCATGTAAAT GTGGTGTAAAGCAGGAACAGCGTACTGGTCTGGACGCTGTTATGCATTTTGGTACATTGAGTCGTGAAGA TCTTGAGATTGGTTATACCGTGGACTGTTCTTGCGGTAAAAAGCTAATTCATTGTGTACGATTTGATGTA CCATTTTTAATTTGCAGTAATACACCTGCTAGTGTAAAATTACCTAAGGGTGTAGGAAGTGCAAATATTT TTATAGGTGATAAGGTTGGTCATTATGTTCATGTTAAGTGTGAACAATCTTATCAGCTTTATGATGCTTC TAATGTTAAGAAGGTTACAGATGTTACTGGCAAGTTGTCAGATTGTCTGTATCTTAAAAATTTGAAACAA ACTTTTAAATCGGTGTTAACCACCTATTATTTGGATGATGTTAAGAAAATTGAGTATAAACCTGACTTGT CACAATATTATTGTGACGGAGGTAAGTATTATACTCAGCGTATTATTAAAGCCCAATTTAAAACATTCGA GAAAGTAGATGGTGTGTATACTAATTTTAAATTGATAGGACACACCGTCTGTGACAGTCTTAATGCTAAG TTGGGTTTTGATAGCTCTAAAGAGTTTGTTGAATATAAGATTACTGAGTGGCCAACAGCTACAGGTGATG TGGTGTTGGCTACTGATGATTTGTATGTTAAGAGATATGAGAGGGGTTGTATTACTTTTGGTAAACCTGT TATATGGTTAAGCCATGAGAAAGCTTCCCTCAATTCTTTAACATATTTTAATAGACCTTCATTGGTTGAT GATAATAAATTTGATGTTTTAAAAGTGGATGATGTTGACGATGGTGGTGACAGCTCAGAGAGTGGTGCCA AAGAAACCAAAGAAATCAACATTATTAAGTTAAGTGGTGTTAAAAAACCATTTAAGGTTGAAGATAGTGT CATTGTTAATGATGATACTAGTGAAACCAAATATGTTAAGAGTTTGTCTATTGTTGATGTGTATGATATG TGGCTTACAGGTTGTAAGTATGTTGTTAGAACTGCTAATGCTTTGAGCAGAGCAGTTAACGTACCTACAA TACGTAAGTTTATAAAATTTGGTATGACTCTTGTTAGTATACCAATTGATTTGTTAAATTTAAGAGAGAT TAAGCCTGCTGTTAATGTGGTTAAAGCTGTGCGAAATAAAATTTCTGTATGCTTTAATTTTATTAAATGG CTTTTTGTCTTATTATTTGGCTGGATTAAAATATCCGCTGATAATAAAGTAATCTACACCACAGAAATTG CATCAAAGCTTACGTGTAAGCTTGTAGCTTTAGCTTTTAAAAATGCATTTTTGACATTTAAGTGGAGTAT GGTTGCTAGAGGTGCTTGCATTATAGCGACTATATTTCTATTGTGGTTTAATTTTATATATGCCAATGTA ATTTTTAGTGATTTTTATTTGCCTAAAATCGGTTTCTTGCCGACTTTTGTTGGTAAGATTGCACAGTGGA TTAAGAACACTTTTAGTCTTGTAACTATTTGTGATCTATATTCCATTCAGGATGTGGGTTTTAAGAATCA GTATTGTAATGGAAGTATTGCATGTCAGTTCTGCTTGGCAGGATTTGATATGTTAGATAATTATAAAGCC ATTGATGTAGTACAGTATGAAGCTGATAGGAGAGCATTTGTTGATTATACAGGTGTGTTAAAGATTGTCA TTGAATTGATAGTTAGTTACGCCCTGTATACGGCATGGTTTTATCCATTGTTTGCCCTTATCAGTATTCA GATCTTGACCACTTGGCTGCCTGAGCTTTTTATGCTTAGTACATTACATTGGAGTTTTAGGTTGCTGGTG GCTTTAGCTAATATGTTACCAGCACATGTGTTTATGAGGTTTTATATTATTATTGCCTCTTTTATTAAGC TCTTTAGCTTGTTTAGGCATGTTGCCTATGGTTGTAGTAAATCTGGTTGTTTGTTTTGTTACAAGAGGAA TCGTAGTCTACGTGTTAAATGTAGTACTATCGTTGGTGGCATGATACGCTATTACGATGTTATGGCTAAT GGTGGCACTGGCTTTTGTTCAAAACATCAATGGAATTGCATTGATTGTGATTCTTATAAACCAGGTAATA CTTTTATTACTGTTGAGGCCGCTCTTGATCTATCTAAGGAATTGAAACGGCCCATTCAGCCTACAGATGT TGCTTATCATACGGTTACTGATGTTAAGCAAGTTGGTTGTTCTATGCGCTTGTTCTATGATCGTGATGGA CAGCGCACATATGATGATGTTAATGCTAGTTTGTTTGTGGATTATAGTAATTTGCTACATTCTAAGGTTA AGAGTGTGCCTAATATGCATGTTGTGGTAGTGGAAAATGATGCTGATAAAGCCAATTTTCTGAATGCTGC TGTATTTTATGCACAGTCTTTGTTTAGACCTATTTTAATGGTTGATAAAAATCTGATAACTACTGCTAAC ACTGGTACGTCTGTTACAGAAACTATGTTTGATGTTTATGTGGATACATTTTTGTCTATGTTTGATGTGG ATAAAAAGAGTCTTAATGCTTTAATAGCAACTGCGCATTCTTCTATAAAACAGGGTACGCAGATTTATAA AGTTTTGGATACCTTTTTAAGCTGTGCTCGTAAAAGTTGTTCTATTGATTCAGATGTTGATACTAAGTGT TTAGCTGATTCTGTCATGTCTGCTGTATCGGCAGGTCTTGAATTGACGGATGAAAGTTGTAATAACTTGG TGCCAACATATTTGAAGAGTGACAACATTGTGGCAGCTGATTTAGGTGTTCTGATTCAAAATTCTGCAAA GCATGTGCAGGGTAATGTTGCTAAAATAGCTGGTGTTTCCTGTATATGGTCTGTGGATGCTTTTAATCAG TTTAGTTCTGATTTCCAGCATAAATTGAAGAAAGCATGTTGTAAAACTGGTTTGAAACTGAAGCTTACTT ATAATAAGCAGATGGCTAATGTCTCTGTTTTAACTACACCCTTTAGTCTTAAAGGGGGTGCAGTTTTTAG TTATTTTGTTTATGTGTGTTTTGTGTTGAGTTTGGTCTGTTTTATTGGACTGTGGTGCTTAATGCCCACT TACACAGTACACAAATCAGATTTTCAGCTTCCCGTTTATGCCAGTTATAAAGTTTTAGATAATGGTGTTA TTAGAGATGTTAGCGTTGAAGATGTTTGTTTCGCTAACAAATTTGAACAATTTGATCAATGGTATGAGTC TACATTTGGTCTAAGTTATTATAGTAACAGTATGGCTTGTCCCATTGTTGTTGCTGTAATAGATCAGGAT TTTGGCTCTACAGTGTTTAATGTCCCTACCAAAGTGTTACGATATGGTTATCATGTGTTGCACTTTATTA CACATGCACTTTCTGCTGATGGAGTGCAGTGTTATACGCCACATAGTCAAATATCGTATTCTAATTTTTA TGCTAGTGGCTGTGTGCTTTCCTCTGCTTGCACTATGTTTACAATGGCCGATGGTAGTCCACAACCTTAT TGTTATACAGAGGGGCTTATGCAAAATGCTTCTCTGTATAGTTCATTGGTACCTCACGTGCGGTATAATC TTGCTAATGCTAAAGGTTTTATCCGTTTTCCAGAAGTGTTGCGAGAAGGGCTTGTACGTATCGTGCGTAC TCGTTCTATGTCGTATTGCAGAGTTGGATTATGTGAGGAAGCTGATGAGGGTATATGCTTTAATTTTAAT GGTTCTTGGGTGCTTAATAATGATTATTATAGATCATTGCCTGGGACCTTTTGTGGTAGAGATGTTTTTG ATTTAATTTATCAGCTATTTAAAGGTTTAGCACAGCCTGTGGATTTTTTGGCATTGACTGCTAGTTCCAT TGCTGGTGCTATACTCGCTGTAATTGTTGTTTTGGTGTTTTATTACCTAATAAAGCTTAAACGTGCTTTT GGTGATTACACCAGTGTTGTTTTTGTTAACGTGATTGTGTGGTGTGTAAATTTTATGATGCTTTTTGTGT TTCAAGTTTACCCCATACTTTCTTGTGTATATGCTATTTGTTATTTTTATGCCACGCTTTATTTCCCTTC GGAGATAAGTGTGATAATGCACTTACAATGGCTAGTTATGTATGGCACTATTATGCCTTTATGGTTTTGT TTGCTATATATAGCTGTTGTTGTTTCAAATCATGCTTTTTGGGTATTTTCTTACTGCAGAAAGCTTGGTA CTTCTGTTCGTAGTGATGGTACATTTGAAGAAATGGCTCTCACTACTTTTATGATTACAAAAGATTCTTA TTGTAAGCTTAAGAATTCTTTGTCTGATGTTGCTTTTAATAGATATTTGAGTTTGTATAATAAATATAGG TATTACAGCGGTAAAATGGATACTGCTGCATATAGGGAGGCTGCTTGCTCTCAGTTGGCTAAAGCAATGG ACACATTTACCAATAATAATGGTAGTGATGTGCTTTACCAACCGCCTACTGCTTCCGTCTCAACTTCATT CTTGCAATCTGGTATTGTGAAAATGGTAAATCCTACTTCTAAGGTAGAACCATGTGTTGTCAGTGTTACC TATGGTAATATGACATTGAATGGTTTATGGTTGGATGACAAGGTCTACTGTCCCAGACATGTAATATGTT CTGCTTCAGATATGACTAATCCAGATTATACAAATTTGTTGTGTAGAGTAACATCAAGTGATTTTACTGT ATTGTTTGATCGTCTAAGCCTTACAGTGATGTCTTATCAAATGCGGGGTTGTATGCTTGTTCTTACAGTG ACCCTGCAAAATTCTCGTACGCCAAAATATACATTTGGTGTGGTTAAACCTGGTGAGACTTTTACTGTTT TAGCTGCTTATAACGGCAAACCACAAGGAGCCTTTCATGTAACTATGCGTAGTAGTTATACCATTAAGGG TTCCTTTTTATGCGGATCTTGTGGATCTGTTGGTTATGTAATAATGGGTGATTGTGTTAAATTTGTTTAT ATGCATCAATTGGAGCTTAGTACTGGTTGTCATACTGGTACTGACTTCAATGGGGATTTTTATGGTCCTT ATAAGGATGCTCAGGTTGTTCAGTTGCTCATTCAGGATTATATACAATCTGTTAATTTTGTAGCATGGCT TTATGCTGCTATACTTAACAATTGTAATTGGTTTGTACAAAGTGATAAGTGTTCTGTAGAAGATTTTAAT GTGTGGGCTCTGTCCAATGGATTTAGCCAAGTTAAATCTGACCTTGTTATAGATGCTTTAGCTTCTATGA CTGGTGTGTCTTTGGAAACACTGTTGGCTGCTATTAAGCGTCTTAAGAATGGTTTCCAAGGACGTCAGAT TATGGGTAGTTGCTCTTTTGAGGATGAATTGACACCTAGCGATGTTTATCAACAACTCGCTGGTATCAAG TTACAATCAAAACGCACTAGATTGTTTAAAGGCACTGTTTGTTGGATTATGGCTTCTACATTTTTGTTTA GTTGCATAATTACAGCATTTGTGAAATGGACTATGTTTATGTATGTAACTACTAATATGTTTAGTATTAC GTTTTGTGCACTTTGTGTTATAAGTTTGGCCATGTTGTTGGTTAAGCATAAGCATCTTTATTTGACTATG TATATAACTCCTGTGCTTTTTACACTGTTGTATAACAACTATTTGGTTGTGTACAAGCATACATTTAGAG GCTATGTCTATGCATGGCTATCATATTATGTTCCATCAGTTGAGTACACTTATACTGATGAAGTTATTTA TGGCATGTTATTGCTTGTAGGAATGGTCTTTGTTACATTACGTAGCATTAACCATGATTTGTTTTCTTTT ATAATGTTTGTTGGTCGTTTGATTTCTGTTTTCTCTTTGTGGTACAAGGGTTCTAACTTAGAGGAAGAAA TTCTTCTTATGTTGGCTTCCCTTTTTGGTACTTACACATGGACAACAGTTTTATCTATGGCTGTAGCAAA GGTTATTGCTAAGTGGGTTGCTGTGAATGTCTTGTATTTCACAGATATACCTCAAATTAAGATAGTGCTT TTGTGCTATTTGTTTATTGGTTATATTATTAGCTGTTATTGGGGCTTGTTTTCCTTGATGAACAGTTTGT TTAGAATGCCTTTGGGTGTTTATAATTATAAAATTTCAGTACAGGAATTAAGATATATGAATGCTAATGG ATTGCGCCCTCCTAAGAATAGTTTTGAAGCCCTTATGCTTAATTTTAAGCTGTTGGGTATTGGAGGTGTT CCAATCATTGAAGTATCTCAATTTCAATCAAAATTGACTGATGTCAAATGTGCTAATGTCGTCTTGCTTA ATTGCTTGCAACATTTGCATGTTGCTTCTAATTCTAAGTTGTGGCATTATTGTAGCACTTTGCACAATGA AATACTTGCCACTTCGGATCTGAGTGTTGCTTTTGAAAAGCTTGCTCAGTTATTAATTGTTTTGTTTGCT AATCCAGCTGCTGTGGATAGCAAGTGCCTGACTAGTATTGAAGAAGTTTGCGATGATTACGCAAAGGACA ATACTGTTTTGCAGGCTTTACAGAGTGAATTTGTTAATATGGCTAGCTTCGTTGAATATGAAGTTGCTAA GAAAAATCTTGATGAGGCGCGTTTTAGTGGTTCTGCTAATCAACAGCAGTTAAAACAGCTAGAGAAAGCC TGTAATATTGCTAAATCTGCTTATGAACGCGACCGTGCTGTAGCAAAAAAGTTGGAGCGTATGGCTGATT TGGCTCTCACTAATATGTATAAAGAAGCTAGAATTAATGATAAGAAGAGTAAGGTTGTTTCTGCCTTGCA AACTATGCTTTTTAGTATGGTGCGTAAGTTAGATAATCAAGCTCTGAATTCAATATTAGATAACGCTGTG AAGGGTTGTGTACCATTGAATGCAATACCTTCATTGGCAGCAAATACTCTGAATATAATTGTACCAGATA AAAGTGTTTATGACCAGGTAGTTGATAATGTCTATGTTACCTATGCGGGTAATGTATGGCAGATTCAAAC TATCCAGGATTCAGATGGTACAAATAAGCAGTTGAATGAGATATCTGATGATTGTAACTGGCCACTAGTT ATTATTGCAAATCGGTATAATGAGGTATCTGCTACTGTTTTGCAAAATAATGAATTAATGCCTGCTAAGT TGAAAATTCAGGTTGTTAATAGTGGTCCAGATCAGACTTGTAATACACCTACTCAATGTTACTATAATAA TAGTAACAATGGGAAGATTGTTTATGCTATACTTAGTGATGTTGATGGTCTTAAGTATACAAAAATTCTT AAAGATGATGGCAATTTTGTTGTTTTGGAGTTAGATCCTCCTTGTAAATTTACTGTTCAAGATGCTAAAG GTCTTAAAATTAAGTACCTTTATTTTGTAAAAGGTTGTAACACACTAGCAAGAGGCTGGGTTGTTGGTAC AATTTCTTCTACAGTTAGATTGCAAGCTGGAACTGCTACTGAATATGCTTCCAACTCATCTATATTGTCT TTATGTGCGTTTTCTGTAGATCCTAAGAAAACGTATTTAGATTTTATACAACAAGGAGGAACACCTATTG CCAATTGTGTTAAAATGTTGTGTGACCATGCTGGTACCGGTATGGCCATTACTGTTAAACCCGATGCTAC CACTAGTCAGGATTCATATGGTGGTGCGTCTGTTTGTATATATTGCCGCGCACGAGTTGAACACCCAGAT GTTGATGGGTTGTGCAAATTACGCGGCAAGTTTGTACAAGTGCCTGTAGGTATAAAAGATCCTGTGTCTT ATGTTTTGACACATGATGTTTGTCGAGTTTGTGGATTTTGGCGGGATGGAAGTTGTTCATGTGTTAGCAC TGACACTACTGTTCAATCAAAAGATACTAATTTTTTAAACGGGTTCGGGGTACGAGTGTAGATGCCCGTC TCGTACCCTGCGCCAGTGGTTTATCTACTGATGTACAATTAAGGGCATTTGATATTTACAATGCTAGTGT TGCTGGCATTGGTTTACATTTAAAAGTTAATTGTTGCCGTTTTCAGCGTGTTGATGAGAACGGTGATAAA TTAGATCAGTTCTTTGTTGTTAAGAGGACAGATCTGACTATATATAATAGAGAGATGAAATGCTATGAGC GTGTAAAAGATTGTAAGTTTGTGGCTGAACACGATTTCTTTACATTTGATGTAGAAGGTAGTCGTGTGCC ACACATTGTACGCAAGGATTTAACAAAGTATACTATGTTGGATCTTTGCTATGCATTGCGACATTTTGAT CGCAATGATTGCATGCTGCTTTGTGACATTCTCTCTATATATGCTGGTTGTGAACAATCCTACTTTACTA AGAAGGATTGGTATGATTTTGTTGAAAATCCTGATATTATTAATGTGTATAAAAAGCTAGGACCTATTTT TAATAGAGCCCTAGTTAGCGCTACTGAGTTTGCGGACAAATTGGTGGAGGTAGGCTTAGTAGGCGTTTTA ACACTTGATAATCAAGATTTAAATGGTAAATGGTATGATTTTGGTGACTATGTTATTGCAGCCCCAGGAT GTGGTGTTGCTATAGCAGATTCTTATTATTCTTATATCATGCCTATGCTGACCATGTGTCATGCATTGGA TTGCGAATTGTATGTGAATAATGCTTATAGACTATTTGATCTTGTACAGTATGATTTTACTGATTACAAG CTTGAATTGTTTAATAAGTATTTTAAGCACTGGAGTATGCCATATCATCCTAACACTGTTGATTGTCAGG ATGATCGGTGTATTATACATTGTGCTAATTTTAACATACTTTTTAGTATGGTTTTACCTAATACATGTTT TGGGCCTCTTGTTAGGCAAATTTTTGTGGATGGTGTGCCTTTTGTTGTTTCAATTGGCTACCATTATAAA GAACTTGGTATTGTGATGAATATGGATGTGGATACACATCGTTATCGCTTGTCTTTAAAAGACTTGCTTT TATATGCTGCTGATCCAGCTTTGCATGTAGCTTCTGCTAGTGCATTGTATGATTTACGCACTTGCTGTTT TAGTGTTGCCGCTATAACAAGCGGTGTAAAATTTCAAACAGTTAAACCTGGTAATTTTAATCAGGATTTT TATGATTTTGTTTTAAGTAAAGGCCTGCTTAAAGAGGGTAGCTCAGTTGATCTGAAGCACTTTTTCTTTA CACAGGATGGTAATGCTGCTATTACTGATTATAATTATTATAAGTATAATTTGCCCACCATGGTGGACAT TAAGCAGTTGTTGTTTGTTTTGGAAGTTGTTTATAAGTATTTTGAGATTTATGATGGTGGGTGTATACCG GCATCACAAGTCATTGTTAATAATTATGATAAGAGTGCTGGCTATCCATTTAACAAATTTGGAAAAGCCA GGCTCTATTATGAAGCATTATCATTTGAGGAACAGGATGAAATTTACGCTTATACTAAGCGTAATGTCCT GCCAACACTTACTCAAATGAATTTGAAATATGCTATTAGTGCTAAGAATAGAGCCCGCACTGTTGCTGGT GTTTCCATACTTAGTACTATGACTGGCAGAATGTTTCATCAAAAATGTTTGAAAAGTATAGCAGCTACAC GTGGTGTTCCTGTAGTTATAGGCACCACTAAATTTTATGGTGGCTGGGATGATATGTTACGCCGCCTTAT TAAAGATGTTGACAATCCTGTACTTATGGGTTGGGATTATCCTAAGTGTGATCGTGCTATGCCAAACCTA CTACGTATTGTTAGTAGTTTGGTATTAGCCCGAAAACATGAGACATGTTGTTCGCAAAGCGATAGGTTTT ATCGACTTGCGAATGAATGCGCACAAGTTTTGAGTGAAATTGTTATGTGTGGTGGCTGTTATTATGTTAA GCCTGGTGGCACTAGTAGTGGTGATGCAACTACTGCTTTTGCTAATTCAGTCTTTAACATATGTCAAGCT GTTTCAGCCAATGTATGTGCCTTAATGTCATGCAATGGCAATAAGATTGAAGATCTTAGTATACGTGCTC TTCAGAAGCGCTTATACTCACATGTGTATAGAAGTGATAAGGTTGATTCAACCTTTGTCACAGAATATTA TGAATTTTTAAATAAGCATTTTAGTATGATGATTTTGAGTGATGATGGGGTTGTGTGTTATAATTCTGAT TATGCGTCCAAAGGGTATATTGCTAATATAAGTGCCTTTCAACAGGTATTATATTATCAAAATAACGTTT TTATGTCAGAATCCAAATGTTGGGTTGAACATGACATAAATAATGGACCTCATGAATTCTGTTCACAACA CACAATGCTTGTAAAGATGGATGGTGACGATGTCTACCTTCCATATCCTAATCCTAGTCGTATATTAGGA GCTGGATGTTTTGTAGATGATTTGTTAAAGACTGATAGTGTTCTTTTAATAGAACGATTTGTAAGTCTTG CAATAGATGCTTATCCACTTGTGTATCATGAAAATGAAGAATACCAAAAGGTTTTTCGTGTTTATTTGGC GTATATAAAGAAGTTGTACAATGACCTGGGTAATCAGATCTTGGATAGCTACAGTGTTATTTTAAGTACT TGTGATGGACAAAAGTTCACTGATGAGTCCTTTTACAAGAACATGTATTTAAGAAGTGCAGTTATGCAGA GTGTTGGAGCTTGCGTGGTCTGCTCTTCTCAAACATCATTACGTTGTGGCAGTTGCATCAGAAAGCCTCT TCTTTGCTGCAAGTGTTGTTATGATCATGTTATGGCGACTGATCATAAATATGTCTTGAGTGTTTCACCA TATGTGTGTAATGCACCAGGATGTGATGTAAATGATGTTACCAAATTGTATCTAGGTGGTATGTCATATT ATTGTGAAGACCATAAGCCACAATATTCATTCAAGTTGGTAATGAATGGTCTGGTTTTTGGTCTATATAA ACAATCTTGTACAGGATCTCCGTACATAGACGATTTTAATCGTATAGCTAGTTGTAAATGGACCGATGTG GATGATTACATACTAGCTAATGAATGTACAGAGCGCTTGAAATTGTTTGCTGCAGAAACGCAAAAGGCAA CCGAGGAAGCCTTTAAGCAGAGTTATGCATCAGCAACAATACAAGAGATTGTTAGTGAGCGCGAATTGAT TCTCTCTTGGGAGATTGGAAAAGTTAAGCCACCACTTAATAAAAATTATGTTTTTACTGGCTACCATTTT ACTAAAAATGGTAAGACAGTTTTAGGTGAGTATGTTTTTGATAAGAGTGAGTTGACTAATGGTGTGTATT ATCGCGCCACAACCACTTATAAGCTATCTGTAGGAGATGTTTTTGTTTTAACCTCTCATTCAGTAGCTAA TTTAAGTGCTCCTACGCTTGTTCCGCAGGAGAATTATAGTAGTATTAGATTTGCTAGTGTTTATAGTGTG CTTGAGACGTTTCAGAACAATGTTGTTAATTATCAACACATTGGTATGAAACGTTACTGCACCGTGCAAG GACCTCCTGGTACAGGGAAGTCACATCTTGCTATTGGTCTTGCTGTATTCTATTGTACAGCACGTGTTGT ATACACAGCGGCCAGCCATGCAGCTGTTGACGCATTGTGTGAAAAAGCATATAAATTTTTGAATATAAAT GATTGCACTCGTATTGTTCCGGCCAAGGTCAGGGTGGAGTGCTATGATAAGTTTAAAATTAATGACACCA CTCGTAAGTATGTGTTTACTACCATAAATGCATTACCTGAGATGGTGACTGATATTGTTGTTGTAGATGA AGTTAGTATGCTTACCAATTATGAGCTTTCTGTTATTAATGCTCGTATTCGCGCTAAGCATTATGTTTAT ATTGGTGATCCTGCTCAATTGCCAGCACCACGTGTGTTATTGAGCAAGGGTACACTTGAACCTAAATATT TTAACACTGTTACTAAGCTCATGTGTTGCTTAGGGCCAGACATTTTTCTTGGTACATGTTATAGATGTCC TAAGGAAATCGTTGATACAGTGTCCGCCTTGGTTTATGAAAATAAGCTTAAGGCTAAGAATGAGAGTAGT TCATTGTGTTTTAAGGTCTATTATAAGGGCGTTACAACACATGAAAGTTCTAGTGCTGTAAATATGCAGC AGATTTATTTGATTAATAAGTTTTTGAAGGCTAACCCTTTGTGGCATAAAGCTGTTTTTATTAGCCCATA TAATAGTCAGAACTTTGCAGCTAAGCGTGTTTTGGGTTTACAAACCCAAACCGTGGATTCTGCTCAAGGT TCTGAATATGATTATGTTATATATTCACAGACTGCAGAAACAGCGCATTCTGTAAATGTTAATCGCTTCA ATGTTGCTATTACTCGAGCCAAGAAAGGTATTCTTTGTGTTATGAGTAATATGCAGTTGTTTGAAGCATT ACAGTTTACTACATTGACCTTAGATAAAGTGCCACAGGCCGTCGAAACTAAAGTTCAATGTAGTACTAAT TTATTTAAAGATTGTAGCAAGAGTTATAGCGGTTATCACCCAGCTCATGCTCCTTCATTTTTGGCAGTAG ATGACAAATATAAGGCAACTGGCGATTTAGCCGTGTGTCTTGGTATTGGTGATTCTGCTGTTACATATTC AAGATTAATATCACTCATGGGTTTTAAATTGGATGTTACCCTTGATGGGTATTGTAAGCTTTTTATAACT AAAGAAGAAGCTGTTAAACGCGTGCGTGCCTGGGTTGGCTTTGATGCTGAAGGTGCTCATGCCACGCGTG ATAGCATTGGGACAAATTTCCCACTTCAATTAGGATTTTCCACAGGAATTGATTTTGTTGTGGAAGCCAC TGGTTTGTTTGCTGATAGAGATGGTTACAGCTTTAAAAAGGCTGTGGCGAAAGCTCCTCCTGGTGAACAA TTTAAGCACCTCATCCCTTTGATGACGAGAGGTCATCGCTGGGATGTTGTTAGACCTAGAATAGTACAAA TGTTTGCAGATCATTTAATTGATCTGTCTGATTGTGTTGTGCTAGTTACATGGGCAGCCAACTTTGAGCT CACTTGTCTCCGCTACTTTGCAAAAGTAGGGCGTGAGATTTCTTGTAATGTATGCACTAAACGTGCCACA GTTTACAATTCTAGAACTGGTTACTATGGTTGTTGGCGCCATAGTGTTACATGTGATTACTTGTATAATC CACTTATTGTTGATATTCAACAGTGGGGATATATTGGTTCTTTATCAAGTAATCATGATTTATATTGTAG TGTCCATAAAGGAGCACATGTTGCTTCCTCTGATGCTATAATGACACGGTGTTTGGCCGTTTATGATTGC TTTTGCAATAATATTAATTGGAATGTGGAGTATCCCATCATTTCAAATGAGTTAAGTATTAATACCTCTT GTAGGGTCTTGCAGCGTGTGATTCTTAAAGCTGCCATGCTCTGCAACAGATATACTTTGTGTTATGATAT TGGCAACCCAAAAGCGATTGCCTGTGTCAAAGATTTTGATTTTAAGTTCTATGATGCCCAACCAATTGTT AAGTCTGTTAAGACTCTTTTGTATTCTTTTGAGGCACATAAGGACTCTTTTAAAGACGGTTTGTGTATGT TTTGGAACTGTAATGTGGATAAGTATCCACCGAATGCAGTTGTATGTAGATTTGACACTAGAGTGTTGAA TAATTTAAATCTTCCTGGCTGTAATGGAGGTAGTTTGTATGTTAATAAACATGCATTCCACACTAAACCC TTTGCTAGGGCAGCCTTTGAGCATTTGAAGCCTATGCCATTCTTCTATTATTCAGATACGCCTTGTGTGT ATATGGATGGCATGGATGCTAAGCAGGTTGATTATGTACCTTTGAAATCTGCCACGTGCATCACAAGATG CAATTTAGGTGGTGCAGTTTGTTTAAAACATGCTGAAGAGTATCGTGAGTACTTAGAGTCTTACAATACA GCTACTACAGCAGGTTTTACTTTTTGGGTCTATAAGACATTTGATTTTTATAATTTGTGGAATACGTTCA CCAAGCTACAAAGCTTGGAGAATGTTGTATATAATTTAGTCAAGACTGGTCATTATACAGGACAGGCTGG TGAAATGCCTTGTGCCATTATAAATGATAAAGTTGTGGCTAAGATCGATAAGGAGGATGTTGTCATTTTT ATTAATAATACAACATACCCTACTAATGTGGCCGTTGAATTATTTGCCAAGCGCAGTGTTCGACACCACC CAGAGCTTAAGCTCTTTAGAAATTTAAATATAGACGTGTGTTGGAAGCACGTCATTTGGGATTATGCTAG AGAAAGTATATTTTGCAGTAATACCTATGGTGTCTGCATGTATACAGATTTAAAGTTCATTGATAAATTG AATGTCCTTTTTGATGGTCGTGATAATGGTGCTCTTGAAGCTTTTAAACGTTCTAATAATGGCGTTTACA TTTCCACGACAAAAGTTAAGAGTCTTTCGATGATAAGAGGTCCACCGCGTGCTGAATTAAATGGCGTAGT GGTGGACAAGGTTGGAGACACTGATTGTGTGTTTTATTTTGCTGTGCGTAAAGAAGGTCAGGATGTCATC TTCAGCCAATTCGACAGCCTGGGAGTCAGCTCTAACCAGAGCCCACAAGGTAATCTGGGGAGTAATGGTA AACCCGGTAATGTCGGTGGTAATGATGCTCTGTCAATCTCTACTATCTTTACACAAAGCCGTGTTATTAG CTCTTTTACATGTCGTACTGATATGGAAAAAGATTTTATAGCTTTAGATCAAGATGTGTTTATTCAGAAG TATGGTTTGGAGGACTATGCCTTTGAACACATTGTTTATGGTAACTTCAACCAGAAGATTATTGGTGGTT TGCATTTGTTAATAGGCTTGTACCGAAGACAGCAAACTTCCAATCTGGTTGTTCAGGAGTTTGTTTCATA TGACTCCAGCATACACTCTTATTTTATCACTGACGAGAAGAGTGGTGGTAGTAAGAGTGTTTGCACTGTT ATAGATATTTTGTTGGATGATTTTGTGGCTCTTGTTAAGTCACTTAATCTTAATTGTGTGAGTAAGGTTG TTAATGTTAATGTTGATTTTAAAGATTTTCAGTTTATGCTTTGGTGTAACGATGAGAAAGTTATGACTTT CTATCCTCGTTTGCAAGCTGCATCTGACTGGAAGCCTGGTTATTCTATGCCTGTATTATATAAGTATTTG AATTCTCCAATGGAAAGAGTTAGTCTCTGGAATTATGGGAAGCCAGTTACTTTGCCTACAGGCTGTATGA TGAATGTTGCTAAGTATACTCAGTTATGTCAATATCTGAATACTACAACATTAGCTGTACCTGTTAATAT GCGAGTTTTGCATTTAGGTGCAGGTTCAGAAAAAGGAGTAGCACCGGGTTCTGCAGTTCTTAGGCAGTGG TTGCCTGCTGGTACTATTCTTGTAGATAACGATTTATACCCATTTGTTAGTGACAGTGTCGCTACATATT TTGGGGATTGTATAACTTTACCCTTTGATTGTCAATGGGATTTGATAATTTCTGATATGTATGACCCTAT TACTAAGAACATAGGGGAGTACAATGTGAGTAAAGATGGTTTCTTTACATACATTTGTCATATGATTCGA GACAAGTTAGCTCTGGGTGGCAGTGTTGCTATAAAAATAACAGAGTTTTCTTGGAATGCAGAATTATATA AGTTAATGGGGTATTTTGCATTTTGGACTGTGTTTTGCACAAATGCAAATGCTTCTTCTAGTGAAGGATT TTTAATTGGCATAAATTATTTGTGTAAGCCCAAGGTTGAGATAGATGGAAATGTTATGCATGCCAATTAT TTGTTTTGGAGAAATTCCACAGTTTGGAACGGGGGTGCTTATAGCCTGTTTGATATGGCTAAATTCCCGC TTAAGTTGGCTGGTACTGCCGTAATAAATTTAAGAGCAGACCAGATTAATGATATGGTTTATTCCCTTCT TGAAAAGGGTAAACTACTTATTAGAGATACAAATAAAGAAGTTTTCGTTGGTGACAGTTTGGTTAATGTA ATCTAAACTTTAAAAATGGCTGTCGCTTATGCAGACAAGCCTAATCATTTTATCAATTTTCCACTTACCC ATTTTCAGGGTTTTGTGTTAAATTATAAAGGTTTACAATTTCAAATTCTCGATGAAGGAGTGGATTGTAA AATACAAACAGCGCCACACATTAGTCTTACTATGCTGGACATACAGCCTGAAGACTATAAAAGTGTTGAT GTCGCTATTCAAGAAGTTATTGATGATATGCATTGGGGTGATGGTTTTCAGATTAAATTTGAGAATCCTC ACATCCTAGGAAGATGCATAGTTTTAGATGTTAAAGGTGTAGAAGAATTGCATGACGATTTAGTTAATTA CATTCGTGATAAAGGTTGTGTTGCTGACCAATCCAGGAAATGGATTGGCCATTGCACCATAGCTCAACTC ACGGATGCAGCACTGTCCATTAAGGAAAATGTTGATTTTATAAACAGCATGCAATTCAATTATAAAATCA CCATCAACCCCTCATCACCGGCTAGACTTGAAATAGTTAAGCTCGGTGCTGAAAAGAAAGATGGTTTTTA TGAAACCATAGTTAGTCACTGGATGGGAATTCGTTTTGAATACACATCACCCACTGATAAGCTAGCTATG ATTATGGGTTATTGTTGTTTAGATGTGGTACGTAAAGAGCTAGAAGAAGGCGATCTTCCCGAGAATGATG ATGATGCTTGGTTTAAGCTATCGTACCATTATGAAAACAATTCTTGGTTCTTCCGACATGTCTACAGGAA AAGTTTTCATTTCCGTAAGGCTTGTCAAAATTTAGATTGTAATTGTTTGGGGTTTTATGAATCTTCAGTT GAAGAATATTAAACTCAGTGAAAATGTTTTTGCTTCCTAGATTTATTCTAGTTAGCTGCATAATTGGTAG CTTAGGTTTTTACAACCCTCCTACCAATGTTGTTTCGCATGTAAATGGAGATTGGTTTTTATTTGGTGAC AGTCGTTCAGATTGTAATCATATTGTTAATATCAACCCCCATAATTATTCTTATATGGACCTTAATCCTG TTCTGTGTGATTCTGGTAAAATATCATCTAAAGCTGGCAACTCCATTTTTAGGAGTTTTCACTTTACCGA TTTTTATAATTACACAGGCGAAGGTCAACAAATTATTTTTTATGAGGGTGTTAATTTTACGCCTTATCAT GCCTTTAAATGCAACCGTTCTGGTAGTAATGATATTTGGATGCAGAATAAAGGCTTGTTTTATACTCAGG TTTATAAGAATATGGCTGTGTATCGCAGCCTTACTTTTGTTAATGTACCATATGTTTATAATGGCTCCGC ACAAGCTACAGCTCTTTGTAAATCTGGTAGTTTAGTCCTTAATAACCCTGCATATATAGCTCCTCAAGCT AACTCTGGGGATTATTATTATAAGGTTGAAGCTGATTTTTATTTGTCAGGTTGTGACGAGTATATCGTAC CACTTTGTATTTTTAACGGCAAGTTTTTGTCGAATACAAAGTATTATGATGATAGTCAATATTATTTTAA TAAAGACACTGGTGTTATTTATGGTCTCAATTCTACAGAAACCATTACCACTGGTTTTGATCTTAATTGT TATTATTTAGTTTTACCCTCTGGTAATTATTTAGCCATTTCAAATGAGCTATTGTTAACTGTTCCTACGA AAGCAATCTGTCTTAATAAGCGTAAGGATTTTACGCCTGTACAGGTTGTTGATTCGCGGTGGAACAATGC CAGGCAGTCTGATAACATGACGGCGGTTGCTTGTCAACCTCCGTACTGTTATTTTCGTAATTCTACTACC AACTATGTTGGTGTTTATGATATTAATCATGGAGATGCTGGTTTTACTAGCATACTTAGTGGTTTGTTAT ATAATTCACCTTGTTTTTCGCAGCAAGGCGTTTTTAGGTATGATAATGTTAGCAGTGTCTGGCCTCTCTA CCCCTATGGCAGATGTCCCACTGCTGCTGATATTAATATCCCTGATTTACCCATTTGTGTGTATGATCCG CTACCAGTTATTTTGCTTGGCATTCTTTTGGGCGTTGCGATTGTAATTATTGTAGTTTTGTTGTTATATT TTATGGTGGATAATGTTACTAGGCTGCATGATGCTTAGACCATAATCTAAACATGTTTTTGATACTTTTA ATTTCCTTACCAACGGCTTTTGCTGTTATAGGAGATTTAAAGTGTACTTCAGATAATATTAATGATAAAG ACACCGGTCCTCCTCCTATAAGTACTGATACTGTTGATGTTACTAATGGTTTGGGTACTTATTATGTTTT AGATCGTGTGTATTTAAATACTACGTTGTTTCTTAATGGTTATTACCCTACTTCAGGTTCCACATATCGT AATATGGCACTGAAGGGAAGTGTACTATTGAGCAGACTATGGTTTAAACCACCATTTCTTTCTGATTTTA TTAATGGTATTTTTGCTAAGGTCAAAAATACCAAGGTTATTAAAGATCGTGTAATGTATAGTGAGTTCCC TGCTATAACTATAGGTAGTACTTTTGTAAATACATCCTATAGTGTGGTAGTACAACCACGTACAATCAAT TCAACACAGGATGGTGATAATAAATTACAAGGTCTTTTAGAGGTCTCTGTTTGCCAGTATAATATGTGCG AGTACCCACAAACGATTTGTCATCCTAACCTGGGTAATCATCGCAAAGAACTATGGCATTTGGATACAGG TGTTGTTTCCTGTTTATATAAGCGTAATTTCACATATGATGTGAATGCTGATTATTTGTATTTTCATTTT TATCAAGAAGGTGGTACTTTTTATGCATATTTTACAGACACTGGTGTTGTTACTAAGTTTTTGTTTAATG TTTATTTAGGCATGGCGCTTTCACACTATTATGTCATGCCTCTGACTTGTAATAGTAAGCTTACTTTAGA ATATTGGGTTACACCTCTCACTTCTAGACAATATTTACTCGCTTTCAATCAAGATGGTATTATTTTTAAT GCTGTTGATTGTATGAGTGATTTTATGAGTGAGATTAAGTGTAAAACACAATCTATAGCACCACCTACTG GTGTTTATGAATTAAACGGTTACACTGTTCAGCCAATCGCAGATGTTTACCGACGTAAACCTAATCTTCC CAATTGCAATATAGAAGCTTGGCTTAATGATAAGTCGGTGCCCTCTCCATTAAATTGGGAACGTAAGACA TTTTCAAATTGTAATTTTAATATGAGCAGCCTGATGTCTTTTATTCAGGCAGACTCATTTACTTGTAATA ATATTGATGCTGCTAAGATATATGGTATGTGTTTTTCCAGCATAACTATAGATAAGTTTGCTATACCCAA TGGCAGGAAGGTTGACCTACAATTGGGTAATTTGGGCTATTTGCAGTCATTTAACTATAGAATTGATACT ACTGCAACAAGTTGTCAGTTGTATTATAATTTACCTGCTGCTAATGTTTCTGTTAGCAGGTTTAATCCTT CTACTTGGAATAAGAGATTTGGTTTTATAGAAGATTCTGTTTTTAAGCCTCGACCTGCAGGTGTTCTTAC TAATCATGATGTAGTTTATGCACAACACTGTTTCAAAGCTCCTAAAAATTTCTGTCCGTGTAAATTGAAT GGTTCGTGTGTAGGTAGTGGTCCTGGTAAAAATAATGGTATAGGCACTTGTCCTGCAGGTACTAATTATT TAACTTGTGATAATTTGTGCACTCCTGATCCTATTACATTTACAGGTACTTATAAGTGCCCCCAAACTAA ATCTTTAGTTGGCATAGGTGAGCACTGTTCGGGTCTTGCTGTTAAAAGTGATTATTGTGGAGGCAATTCT TGTACTTGCCGACCACAAGCATTTTTGGGTTGGTCTGCAGACTCTTGTTTACAAGGAGACAAGTGTAATA TTTTTGCTAATTTTATTTTGCATGATGTTAATAGTGGTCTTACTTGTTCTACTGATTTACAAAAAGCTAA CACAGACATAATTCTTGGTGTTTGTGTTAATTATGACCTCTATGGTATTTTAGGCCAAGGCATTTTTGTT GAGGTTAATGCGACTTATTATAATAGTTGGCAGAACCTTTTATATGATTCTAATGGTAATCTCTACGGTT TTAGAGACTACATAACAAACAGAACTTTTATGATTCGTAGTTGCTATAGCGGTCGTGTTTCTGCGGCCTT TCACGCTAACTCTTCCGAACCAGCATTGCTATTTCGGAATATTAAATGCAACTACGTTTTTAATAATAGT CTTACACGACAGCTGCAACCCATTAACTATTTTGATAGTTATCTTGGTTGTGTTGTCAATGCTTATAATA GTACTGCTATTTCTGTTCAAACATGTGATCTCACAGTAGGTAGTGGTTACTGTGTGGATTACTCTAAAAA CAGACGAAGTCGTGGAGCGATTACCACTGGTTATCGGTTTACTAATTTTGAGCCATTTACTGTTAATTCA GTAAACGATAGTTTAGAACCTGTAGGTGGTTTGTATGAAATTCAAATACCTTCAGAGTTTACTATAGGTA ATATGGTGGAGTTTATTCAAACAAGCTCTCCTAAAGTTACTATTGATTGTGCTGCATTTGTCTGTGGTGA TTATGCAGCATGTAAATCACAGTTGGTTGAATATGGTAGTTTCTGTGATAACATTAATGCCATACTCACA GAAGTAAATGAACTACTTGACACTACACAGTTGCAAGTAGCTAATAGTTTAATGAATGGTGTTACTCTTA GCACTAAGCTTAAAGATGGCGTTAATTTCAATGTAGACGACATCAATTTTTCCCCTGTATTAGGTTGTCT AGGCAGCGAATGTAGTAAAGCTTCCAGTAGATCTGCTATAGAGGATTTACTTTTTGATAAAGTAAAGTTA TCTGATGTCGGTTTTGTTGAGGCTTATAATAATTGTACAGGAGGTGCCGAAATTAGGGACCTCATTTGTG TGCAAAGTTATAAAGGCATCAAAGTGTTGCCTCCACTGCTCTCAGAAAATCAGATCAGTGGATACACTTT GGCTGCCACCTCTGCTAGTCTATTTCCTCCTTGGACAGCAGCAGCAGGTGTACCATTTTATTTAAATGTT CAGTATCGCATTAATGGGCTTGGTGTCACCATGGATGTGCTAAGTCAAAATCAAAAGCTTATTGCTAATG CATTTAACAATGCCCTTTATGCTATTCAGGAAGGGTTCGATGCAACTAATTCTGCTTTAGTTAAAATTCA AGCTGTTGTTAATGCAAATGCTGAAGCTCTTAATAACTTATTGCAACAACTCTCTAATAGATTTGGTGCT ATAAGTGCTTCTTTACAAGAAATTCTATCTAGACTTGATGCTCTTGAAGCGGAAGCTCAGATAGATAGAC TTATTAATGGTCGTCTTACCGCTCTTAATGCTTATGTTTCTCAACAGCTTAGTGATTCTACACTGGTAAA ATTTAGTGCAGCACAAGCTATGGAGAAGGTTAATGAATGTGTCAAAAGCCAATCATCTAGGATAAATTTC TGTGGTAATGGTAATCATATTATATCATTAGTGCAGAATGCTCCATATGGTTTGTATTTTATCCACTTTA GTTATGTCCCTACTAAGTATGTCACAGCGAGGGTTAGTCCTGGTCTGTGCATTGCTGGTGATAGAGGTAT AGCTCCTAAGAGTGGTTATTTTGTTAATGTAAATAATACTTGGATGTACACTGGTAGTGGTTACTACTAC CCTGAACCTATAACTGAAAATAATGTTGTTGTTATGAGTACCTGCGCTGTTAATTATACTAAAGCGCCGT ATGTAATGCTGAACACTTCAATACCCAACCTTCCTGATTTTAAGGAAGAGTTGGATCAATGGTTTAAAAA TCAAACATCAGTGGCACCAGATTTGTCACTTGATTATATAAATGTTACATTCTTGGACCTACAAGTTGAA ATGAATAGGTTACAGGAGGCAATAAAAGTCTTAAATCAGAGCTACATCAATCTCAAGGACATTGGTACAT ATGAATATTATGTAAAATGGCCTTGGTATGTATGGCTTTTAATCTGCCTTGCTGGTGTAGCTATGCTTGT TTTACTATTCTTCATATGCTGTTGTACAGGATGTGGGACTAGTTGTTTTAAGAAATGTGGTGGTTGTTGT GATGATTATACTGGATACCAGGAGTTAGTAATCAAAACTTCACATGACGACTAAGTTCGTCTTTGATTCA TTGCACTGATCTCTTGTTAGATCTTTTTGCAATCTAGCATTTGTTAAAGTTCTTAAGGCCACGCCCTATT AATGGACATTTGGAGACCTGAGAAGAAATATCTCCGTTATATTAACGGTTTTAATGTCTCAGAATTAGAA GATGCTTGTTTTAAATTTAACTATCAATTTCCTAAAGTAGGATATTGTAGAGTTCCTAGTCATGCTTGGT GCCGTAATCAAGGTAGATTTTGTGCTACATTCACTCTTTATGGTAAATCCAAACATTATGATAAATATTT TGGAGTAATAAATGGTTTCACAGCATTCGCTAATACTGTAGAGGATGCTGTTAACAAACTGGTTTTCTTA GCTGTTGACTTTATTACCTGGCGCAGACAGGAGTTAAATGTTTATGGCTGATGCTTATCTTGCAGACACT GTGTGGTATGTGGGGCAAATAATTTTTATAGTTGCCATTTGTTTATTGGTTACAATAGTTGTAGTGGCAT TTTTGGCAACTTTTAAATTGTGTATTCAACTTTGCGGTATGTGTAATACCTTAGTACTGTCCCCTTCTAT TTATGTGTTTAATAGAGGTAGGCAGTTTTATGAGTTTTACAATGATGTAAAACCACCAGTCCTTGATGTG GATGACGTTTAGGTAATCCAAACATTATGAGTAGTAAAACTACACCAGCACCAGTTTATATCTGGACTGC TGATGAAGCTATTAAATTCCTAAAGGAATGGAATTTTTCTTTGGGTATTATACTACTTTTTATTACAATC ATATTGCAATTTGGATATACAAGTCGCAGTATGTTTGTTTATGTTATTAAGATGATTATTTTGTGGCTTA TGTGGCCCCTTACTATAATCTTAACTATTTTCAATTGCGTATACGCATTGAATAATGTGTATCTTGGCCT TTCTATAGTTTTTACCATAGTGGCCATTATTATGTGGATTGTGTATTTTGTGAATAGTATCAGGTTGTTT ATTAGAACTGGAAGTTTTTGGAGTTTCAACCCAGAAACAAACAACTTGATGTGTATAGATATGAAAGGAA CAATGTATGTTAGGCCGATAATTGAGGACTATCATACTCTGACGGTCACAATAATACGCGGCCATCTTTA CATTCAAGGTATAAAACTAGGTACTGGCTATTCTTTGGCAGATTTGCCAGCTTATATGACTGTTGCTAAG GTTACACACCTGTGCACATATAAGCGTGGTTTTCTTGACAGGATAAGCGATACTAGTGGTTTTGCTGTTT ATGTTAAGTCCAAAGTCGGTAATTACCGACTGCCATCAACCCAAAAGGGTTCTGGCATGGACACCGCATT GTTGAGAAATAATATCTAAATTTTAAGGATGTCTTTTACTCCTGGTAAGCAATCCAGTAGTAGAGCGTCC TCTGGAAATCGTTCTGGTAATGGCATCCTCAAGTGGGCCGATCAGTCCGACCAGTTTAGAAATGTTCAAA CCAGGGGTAGAAGAGCTCAACCCAAGCAAACTGCTACCTCTCAGCAACCATCAGGAGGGAATGTTGTACC CTACTATTCTTGGTTCTCTGGAATTACTCAGTTTCAAAAGGGAAAGGAGTTTGAGTTTGTAGAAGGACAA GGTGTGCCTATTGCACCAGGAGTCCCAGCTACTGAAGCTAAGGGGTACTGGTACAGACACAACAGACGTT CTTTTAAAACAGCCGATGGCAACCAGCGTCAACTGCTGCCACGATGGTATTTTTACTATCTGGGAACAGG ACCGCATGCTAAAGACCAGTACGGCACCGATATTGACGGAGTCTACTGGGTCGCTAGCAACCAGGCTGAT GTCAATACCCCGGCTGACATTGTCGATCGGGACCCAAGTAGCGATGAGGCTATTCCGACTAGGTTTCCGC CTGGCACGGTACTCCCTCAGGGTTACTATATTGAAGGCTCAGGAAGGTCTGCTCCTAATTCCAGATCTAC TTCGCGCACATCCAGCAGAGCCTCTAGTGCAGGATCGCGTAGTAGAGCCAATTCTGGCAATAGAACCCCT ACCTCTGGTGTAACACCTGACATGGCTGATCAAATTGCTAGTCTTGTTCTGGCAAAACTTGGCAAGGATG CCACTAAACCTCAGCAAGTAACTAAGCATACTGCCAAAGAAGTCAGACAGAAAATTTTGAATAAGCCCCG CCAGAAGAGGAGCCCCAATAAACAATGCACTGTTCAGCAGTGTTTTGGTAAGAGAGGCCCTAATCAGAAT TTTGGTGGTGGAGAAATGTTAAAACTTGGAACTAGTGACCCACAGTTCCCCATTCTTGCAGAACTCGCAC CCACAGCTGGTGCGTTTTTCTTTGGATCAAGATTAGAGTTGGCCAAAGTGCAGAATTTATCTGGGAATCC TGACGAGCCCCAGAAGGATGTTTATGAATTGCGCTATAACGGCGCAATTAGGTTTGACAGTACACTTTCA GGTTTTGAGACCATAATGAAGGTGCTGAATGAGAATTTGAATGCCTATCAACAACAAGATGGTATGATGA ATATGAGTCCAAAACCACAGCGTCAGCGTGGTCATAAGAATGGACAAGGAGAAAATGATAATATAAGTGT TGCAGTGCCCAAAAGCCGCGTGCAGCAAAATAAGAGTAGAGAGTTGACTGCAGAGGACATCAGCCTTCTT AAGAAGATGGATGAGCCCTATACTGAAGACACCTCAGAAATATAAGAGAATGAACCTTATGTCGGCATCT GGTGGTAACCCCTCGCAGAAAAGTCGAGATAAGGCACTCTCTATCAGAATGGATGTCTTGCTGCTATAAT AGATAGAGAAGGTTATAGCAGACTATAGATTAATTAGTTGAAAGTTTTGTGTTGTAATGTATAGTGTTGG AGAAAGTGAAAGACTTGCGGAAGTAATTGCCGACAAGTGCCCAAGGGAAGAGCCAGCATGTTAAGTTACC ACCCAGTAATTAGTAAATGAATGAAGTTAATTATGGCCAATTGGAAGAATCACAAAAAAAAAAAAAAAAA AAAAAAAAAAA
    Click to Show/Hide
References
1 The SARS-CoV-2 RNA interactome. Mol Cell. 2021 Jul 1;81(13):2838-2850.e6.
2 Computational Mapping of the Human-SARS-CoV-2 Protein-RNA Interactome. bioRxiv. 2021 Dec; DOI:.org/10.1101/2021.12.22.472458.