Details of Virus RNA

Virus RNA General Information
Strain Information	Strain Name	hCoV-19/Wuhan-Hu-1/2019
	Strain Family	Beta (B.1.351)
	GISAID Accession	EPI_ISL_402125 Info Collection Date: 2019/12/31 Originating Lab: National Institute for Communicable Disease Control and Prevention (ICDC) Chinese Center for Disease Control and Prevention (China CDC) Submitting Lab: National Institute for Communicable Disease Control and Prevention (ICDC) Chinese Center for Disease Control and Prevention (China CDC) Authors: Zhang, Y.-Z., Wu, F., Chen, Y.-M., Pei, Y.-Y., Xu, L., Wang, W., Zhao, S., Yu, B., Hu, Y., Tao, Z.-W., Song, Z.-G., Tian, J.-H., Zhang, Y.-L., Liu, Y., Zheng, J.-J., Dai, F.-H., Wang, Q.-M., She, J.-L. and Zhu, T.-Y.	EPI_SET ID	EPI_SET_220823ya
	Strain Mutation Site	P71L; T205I; K1655N; D80A; D215G; K417N; A701V; N501Y; E484K
	RNA Binding Site	3'-UTR
Virus Information	Virus Name	Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
Virus Information	Taxonomy ID	2697049

Virus RNA - Host Protein Network
Regulation Network
Regulation Network		Network Download

Full list of proteins interacting with the 3'-UTR of this Strain
*hnRNP A1 messenger RNA (HNRNPA1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*hnRNP A1 messenger RNA (HNRNPA1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*IGF2-binding protein 1 (IMP-1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Polyadenylate-binding protein 1 (PABPC1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Polypyrimidine tract-binding protein (PTBP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Polypyrimidine tract-binding protein (PTBP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*hnRNP A2/B1 messenger RNA (HNRNPA2B1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Heterogeneous nuclear ribonucleoprotein L (LGALS4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Heterogeneous nuclear ribonucleoprotein L (LGALS4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Heterogeneous nuclear ribonucleoprotein K (HNRNPK)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Heterogeneous nuclear ribonucleoprotein K (HNRNPK)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*ELAV-like protein 1 (ELAVL1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*NonO protein (NONO)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*NonO protein (NONO)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*40S ribosomal protein S3a (RPS3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Ankyrin repeat and SOCS box protein 3 (ASB-3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 23
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Ankyrin repeat-containing cofactor 2 (ANCO2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 20
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*APOBEC1 complementation factor (ACF)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*ATP-dependent helicase 1 (hHEL1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 17
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Basal cell adhesion molecule (CD239)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 16
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Bis(5'-adenosyl)-triphosphatase ENPP4 (E-NPP 4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 18
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*BTB/POZ domain-containing protein 7 (BTBD7)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 24
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Cadherin-9 (CDH9)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 28
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Calcium-binding mitochondrial carrier protein (SCaMC-1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 26
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Catenin alpha-3 (CTNNA3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 18
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Class A basic helix-loop-helix protein 26 (HAND2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 102
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Cleavage factor Im complex 68 kDa subunit (CFIm68)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Cleavage stimulation factor 64 kDa subunit (CstF-64)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Coiled-coil domain-containing protein 25 (COL6A5)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 16
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Collagen alpha-5(VI) chain*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 26
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Conserved oligomeric Golgi complex subunit 4 (COG4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 17
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*CPE-binding protein 4 (hCPEB-4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*CSTF 64 kDa subunit tau variant (TauCstF-64)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*CUGBP Elav-like family member 2 (CELF2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*CUGBP Elav-like family member 6 (CELF6)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Cyclin-K (CCNK)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 22
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Cytosolic phospholipase A2 (GIVA cPLA2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 53
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*DEAD box protein 24 (DDX24)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 40
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*DEAD box protein 59 (DDX59)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*DNA polymerase theta (TRIM71)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 18
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Dynein axonemal heavy chain 2 (EIF5B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 33
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*EBNA2 coactivator p100 (SND1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*ELAV-like protein 2 (ELAVL2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Epithelial splicing regulatory protein 2 (ESRP2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Far upstream element-binding protein 2 (KHSRP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Far upstream element-binding protein 3 (FUBP3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*FK506-binding protein 4 (FKBP4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*FLICE-associated huge protein (FLASH)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 36
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*G patch domain-containing protein 7 (VG5Q)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*G-patch domain-containing protein 5 (GPKOW)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*G-rich sequence factor 1 (GRSF1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*G-rich sequence factor 1 (GRSF1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*GAP SH3 domain-binding protein 1 (G3BP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*GAP-associated tyrosine phosphoprotein p62 (KHDRBS1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*GAP-associated tyrosine phosphoprotein p62 (KHDRBS1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*GPI ethanolamine phosphate transferase 2 (PIGG)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 18
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*GRAM domain-containing protein 4 (H2AC14)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 29
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Helicase-like protein 2 (HLP2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Heterogeneous nuclear ribonucleoprotein F (HNRNPF)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Heterogeneous nuclear ribonucleoprotein H (HNRNPH1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Heterogeneous nuclear ribonucleoprotein H2 (HNRNPH2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Heterogeneous nuclear ribonucleoprotein H3 (HNRNPH3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Heterogeneous nuclear ribonucleoprotein M (HNRNPM)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*hFXR1p (FXR1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Histone H3-K9 methyltransferase 5 (GLP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 24
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*hnRNP C-like-1 (HNRPCL1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*hnRNP core protein A1-like 2 (HNRNPA1L2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Homeobox protein DBX2 (DBX2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 26
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*IF-4-gamma 2 (EIF4G2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*IGF2-binding protein 2 (IMP-2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*IGF2-binding protein 2 (IMP-2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Interleukin enhancer-binding factor 3 (ILF3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*LIM domain and actin-binding protein 1 (LIMA1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 26
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Lysine-specific demethylase 7A (KDM7A)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 24
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Lysine-specific demethylase PHF2 (PHF2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 24
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*m6A(m)-demethylase FTO (KIAA1752)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*MaFF-interacting protein (DDX52)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 16
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Matrin-3 (MATR3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*MEK kinase kinase 4 (MAP4K4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 18
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Microtubule-actin cross-linking factor 1 (MACF1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 34
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Microtubule-associated protein 1B (MAP1B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 22
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*mRNA decay activator protein ZFP36 (ZFP36)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*mRNA-decapping enzyme 1B (DCP1B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 51
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Muscleblind-like protein 1 (MBNL1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*NAC-alpha domain-containing protein 1 (NACAD)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 44
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Non-lysosomal glucosylceramidase (GBA2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 27
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Nuclear autoantigenic sperm protein (NASP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 218
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Nuclear cap-binding protein subunit 2 (NCBP2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Nucleolar protein NAP57 (DKC1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Nucleolysin TIAR (TIAL1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Nucleolysin TIAR (TIAL1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Oxidative stress-associated Src activator (OSSA)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*PDZ domain-containing protein 7 (PDZD7)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 13
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Peptidyl-prolyl cis-trans isomerase E (PPIE)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Periodontal ligament-associated protein 1 (PLAP-1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 24
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Phospholipid-transporting ATPase VB (H1-5)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 39
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Phospholipid-transporting ATPase VD (UTP11)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 39
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Platelet endothelial cell adhesion molecule (PECAM1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 24
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Poly(rC)-binding protein 1*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Poly(rC)-binding protein 2*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Polyadenylate-binding protein 4 (PABPC4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Probable RNA-binding protein 46 (RBM46)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Progesterone-induced-blocking factor 1 (PIBF1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 23
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Protein AATF (RBFOX2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Protein piccolo (PCLO)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 27
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Protocadherin Fat 4 (FAT4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 38
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Pumilio homolog 2 (PUM2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Rab5 GDP/GTP exchange factor (ZNF711)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 24
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*RERG/Ras-like protein (RERGL)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 15
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Retinaldehyde dehydrogenase 3 (RALDH-3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 21
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Rho GTPase-activating protein 23 (PPP2R1B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 16
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Ribosomal protein S6 kinase beta-2 (RPS6KB2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 24
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*RNA-binding motif, single-stranded-interacting protein 3 (RBMS3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*RNA-binding protein 24 (RBM24)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*RNA-binding protein 43 (RBM43)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 18
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*RNA-binding protein 56 (TAFII68)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*RNA-binding protein EWS (EWSR1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*RNA-binding protein FUS (FUS)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*RNA-binding protein Nova-1 (NOVA1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*RNA-binding protein Raly (RALY)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*SAC2 suppressor of actin mutations 2-like protein (VPS52)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 16
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Sam68-like mammalian protein 2 (SLM-2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Scaffold attachment factor B2 (SAFB2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*SCAN domain-containing protein 3 (PLAAT4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 20
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Serine/arginine-rich splicing factor 1 (SRSF1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Serine/arginine-rich splicing factor 1 (SRSF1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Serine/arginine-rich splicing factor 10 (SRSF10)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Serine/arginine-rich splicing factor 2 (SRSF2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Serine/arginine-rich splicing factor 5 (SRSF5)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Serine/arginine-rich splicing factor 9 (SRSF9)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Serine/arginine-rich splicing factor 9 (SRSF9)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Serine/threonine-protein kinase pim-1 (PIM1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 18
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*SH3 and PX domain-containing protein 2A (SH3BP4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 18
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*SH3 domain-binding protein 4 (H1-3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 28
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Splicing factor 3A subunit 3 (SF3A3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Splicing factor U2AF 65 kDa subunit (U2AF2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Splicing factor U2AF 65 kDa subunit (U2AF2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*SURP and G-patch domain-containing protein 2 (SUGP2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Synaptic functional regulator FMR1 (FMR1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Syntrophin-3 (SNT3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 27
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*T-cell-restricted intracellular antigen-1 (TIA-1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*TAR DNA binding protein 43 (TARDBP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*TAR DNA binding protein 43 (TARDBP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Tat-interacting protein of 110 kDa (Tip110)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Testis-expressed protein 10 (TEX10)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 22
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Testis-expressed protein 15 (TEX15)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 31
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Testis-expressed protein 2 (TEX2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 19
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Toll-like receptor 3 (TLR3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 31
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*TRAF2 and NCK interacting kinase (TNIK)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 22
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Transmembrane protein 200C (RASAL3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 29
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*TREK-2 K(+) channel subunit*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 27
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Treslin (TICRR)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 29
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Tubulin alpha-1A chain (TRIP11)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 536
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*UAP56-interacting factor (TMEM38B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 18
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Uncharacterized protein KIAA1143 (ATP8B1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 29
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*UPF0415 protein C7orf25 (ZNF506)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 29
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Vesicular glutamate transporter 2 (MAP4K4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 29
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*WD repeat-containing protein 90 (WDR90)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 26
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Y-box-binding protein 1 (YBX1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Y-box-binding protein 3 (YBX3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*YTH domain-containing protein 1 (YTHDC1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Zinc finger CCHC domain-containing 1 (Lin-28A)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Zinc finger FYVE domain-containing protein 24 (FGD6)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 15
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Zinc finger protein 261 (ZMYM3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 18
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Zinc finger protein 265 (ZRANB2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Interaction Type	Potential binding protein
Description of Detection Method	ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
*Zinc finger protein 265 (ZRANB2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	K562 cells (Human leukemic cell line) (CVCL_0004 )
Cell Originated Tissue	Bone marrow
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
*Zinc finger protein 592 (HSP90AA2P)*
Protein Details	Pro Info Click to show the detail information of this Protein	[3]
Infection Time	48 h
Infection Cells	HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 )
Cell Originated Tissue	Liver
Interaction Score	Prot score = 23
Description of Detection Method	RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
*Zinc finger protein 800 (ZNF800)*
Protein Details	Pro Info Click to show the detail information of this Protein	[2]
Infection Cells	HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 )
Cell Originated Tissue	Liver
Interaction Type	Potential binding protein
Description of Detection Method	ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm

Virus RNA Sequence Information (Source: GISAID)
>hCoV-19/Wuhan/Hu-1/2019\|EPI_ISL_402125\|2019-12-31 ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAA AATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGG ACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGC CTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACAT CTTAAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAA ACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAG AACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGA TCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACG GAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTA GCACGTGCTGGTAAAGCTTCATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCG TGAACATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAAT TGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAA CCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCACCAAATGAATG CAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCAGACGGGCGATTTTGTTAAAG CCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAAATGCTGTT GTTAAAATTTATTGTCCAGCATGTCACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGG CTTGAAAACCATTCTTCGTAAGGGTGGTCGCACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACA AGTGTGCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGT CTTAATGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGA GATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGATTATAAAGCAT TCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAGGTGCCTGGAATATTGGTGAA CAGAAATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCGTGTTGTACGATCAATTTTCTCCCGCACTCT TGAAACTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCCGCTATAACAATACTAGATGGAATTTCACAGTATTCACTGA GACTCATTGATGCTATGATGTTCACATCTGATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTT GTTCAGTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGA AGAGAAGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAA TTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGTAAATAAATTT TTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTAGGTGAAACATTTGTCACGCA CTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCCTACTCATGCCTCTAAAAGCCCCAAAAGAAA TTATCTTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTTAACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCA TTAGAACAACCTACTAGTGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGA AATCAAAGACACAGAAAAGTACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTG CACCAACAAAGGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTT GATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAAATGAGTTCGC CTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACCACTGGGCATTGATTTAGATG AGTGGAGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAATTGGCTTCACATATGTATTGTTCTTTCTAC CCTCCAGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAGAAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGA AGATGATTACCAAGGTAAACCTTTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATT GGTTAGATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATT GTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTT AAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAACCAACAGTGGTTGTTA ATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTACTAACAATGCCATGCAAGTT GAATCTGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAA ACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTA ATCAGCACGAAGTTCTACTTGCACCATTATTATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGT GTAGATACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGA AATGAAGAGTGAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTA AACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAA ACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCAGATTCTGCCACTCTTGTTAG TGACATTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTG TGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTAT ATAACCACTTACCCGGGTCAGGGTTTAAATGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGC CTTTTACATTCTACCATCTATTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGC TTGCACATGCAGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAA TATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAACAACTGTAGC GTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTATGTAACACATGGCTTAAATT TGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCG TATAATGGTTATCTTACTTCTTCTTCTAAAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAA AGATTGGTCCTATTCTGGACAATCTACACAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTA GTAATCCTACCACATTCCACCTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTG AGGACTATTAAGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACA ACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGTAAAACATTTT ATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTGATCCTAGTTTTCTGGGTAGG TACATGTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAA CAACTGTTATCTTGCCACTGCATTGTTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTT ATTACAGAGCAAGGGCTGGTGAAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTA GGTGATGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTG TAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAAT TTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTCACCTTTTGTT ATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGTGAGTACACTGGTAATTACCA GTGTGGTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAAT ACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGTTACACAACAACCATAAAACCAGTTACTTATAAATTGGAT GGTGTTGTTTGTACAGAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAAT TGATCTTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTG ATGATTTAAACCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGT GATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAACCTATTGTTTG GCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTGTCTTTGGAGCACAAAACCAG TTGAAACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAA CCAGTCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGT AGGAGACATTATACTTAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTT ATGTAGACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCAT GGTTTAGCTGCTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTAC AACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTATTGCTACAAT TGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAGCAAAGAATACTGTTAAGAGT GTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTATAATTTG GTTTTTACTATTAAGTGTTTGCCTAGGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCA TGCCTTCTTACTGTACTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCT ATACCTTGTAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTC ATCTTTTAAATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCT ATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTCTTGGCTTATG TGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATCTTCTTTGCATCATTTTATTA TGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAA CAAGAGTCGAATGTACAACTATTGTTAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGC AAACTACACAATTGGAATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGA CTTGTCACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATG GTTCCATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC AACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAATGTGAAGAATC ATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACTAGATCAGGCATTAGTGTCTG ATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCA ATGGAAAAACTCAAAACACTAGTTGCAACTGCAGAAGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTAC TTTTATTTCAGCAGCTCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCAC ATCAATCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCC CGTGACCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGAT ATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAGAATAACTTAC CTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAGCACTTAAGGGTGGTAAAATT GTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACC TGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTG ACATAGCATCTACAGATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTAT ACTAATGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCAC GATATTACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACAC CATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTTTAAAGATGCT TCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTATGAAAGTTTACGCCCTGACAC ACGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTT TTGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTA CTTAACAATGATTATTACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTAC ACCACTAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACAT GCCTTGCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTC CTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTTACTTGTACTT GACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTTCACACCTTTAGTACCTTTCT GGATAACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTA GTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAA GTTGCGTAGTGATGTGCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTG GAGCAATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGT TCTGATGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCC ATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTTGATGACGTAG TTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAGATTTACTCATTCGTAAGTCT AATCATAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCT TAAGGTTGATACAGCCAATCCTAAGACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAG CTTGTTACAATGGTTCACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAAT GGTTCATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAAC TGGAGTTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTA CGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTTTCTCAATCGA TTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTAACACAAGACCATGTTGACAT ACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAATGGTA TGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGT GTTACTTTCCAAAGTGCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTT AGTTTTAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTA TTGCTATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCC ACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATATGGTTGATAC TAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACTAATCCTTATGACAGCAAGAA CTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAAT GCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCAT GTTTTTGGCCAGAGGTATTGTTTTTATGTGTGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTA TAATGCTAGTTTATTGTTTCTTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGA CTGACTCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAA GAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTAGCCACTGTAC AGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCATCT AAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAAAGATACTACTGAAGCCTTTGAAAAAATGGT TTCACTACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTAGACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGG CAACCTTACAAGCTATAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAG CAGGCTGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGA CCGTGATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTG AGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAATGATGCACTC AACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACAACAGCAGCCAAACTAATGGT TGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACATTTACTTATGCATCAGCATTGTGGGAAATCC AACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAGTGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCT CTTATTGTAACAGCTTTAAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGAT GTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTA GGTTTGTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATC TATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTATACTTTATTAA AGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCTACAAGCTGGTAATGCAACAG AAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCT AGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACC GGAAGCCAATATGGATCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATC CTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTT AAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCA GTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAG TACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTT GTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTAC CAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGA CGGTGACATGGTACCACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATT TTGATGAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAG GACTGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTT AAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAAGATCTCAATG GTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTG TTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAA GTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACAT ACCACCCAAATTGTGTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTG TTCCCACCTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCA CTTCAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGT ATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTCAGTAGCTGCA CTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGG TTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATG ACTACTATCGTTATAATCTACCAACAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTT GATTGTTACGATGGTGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAA TAAATGGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTA ATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC TCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAGGAGCTACTGT AGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTAGAAAACCCTCACC TTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGC AAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGT CATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTT TTAACATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTC CGCAATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGC ATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTATGCATCTCAAG GTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGG ACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGT GTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACAC TTATGATTGAACGGTTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTC TTTCATTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCT TACTAATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTG TTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTTATGTTGTAAA TGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTATGTTTGCAATGCTCCAGGTTG TGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATTGTAAATCACATAAACCACCCATTAGTTTTC CATTGTGTGCTAATGGACAAGTTTTTGGTTTATATAAAAATACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCA ATTGCAACATGTGACTGGACAAATGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGC AGAAACGCTCAAAGCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAG AATTACATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACT AAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACCGAGGTACAAC AACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATTAAGTGCACCTACACTAGTGC CACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATCTCAGATGAGTTTTCTAGCAATGTTGCAAAT TATCAAAAGGTTGGTATGCAAAAGTATTCTACACTCCAGGGACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCT AGCTCTCTACTACCCTTCTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCAT TAAAATATTTGCCTATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTG AATTCAACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGA AATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTACATTGGCGACC CTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTT ATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTT GGTTTATGATAATAAGCTTAAAGCACATAAAGACAAATCAGCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGC ATGATGTTTCATCTGCAATTAACAGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAA GCTGTCTTTATTTCACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTC ATCACAGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTA ATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTTGCAATTTACA AGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGT AATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTG ACATACCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAAT GGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTG TCATGCTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTAC CTACAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAA CACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAAGTGACACACT TAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATCTATGAAGTATTTTGTGAAAA TAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGG CATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACA AAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAG CTGTCCACGAGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCG GCTTGTAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAA CCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGTGACAAAGCTT ATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTGTATGCCTATTTTGGAATTGC AATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTG TGATGGTGGCAGTTTGTATGTAAATAAACATGCATTCCACACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAAC AATTACCATTTTTCTATTACTCTGACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCA CTAAAGTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTA TCTCGATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGA ACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGGACAACAGGGT GAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTAGAATTGTTTGAAAATAAAAC AACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTAAACCAGTACCAGAGGTGAAAATACTCAATA ATTTGGGTGTGGACATTGCTGCTAATACTGTGATCTGGGACTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGT GTTTGTTCTATGACTGACATAGCCAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGT TGATGGTCAAGTAGACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCAT CTGTAGGTCCCAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAG AAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTAAACCCAGGAG TCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATTAGAAGGCTATGCCTTCGAAC ATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAA TCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTACAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTC ATCTAAGTGTGTGTGTTCTGTTATTGATTTATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAG TTTCTAAGGTTGTCAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACA TTTTACCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCT ATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTCGCAAAATATA CTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTATACATTTTGGTGCTGGTTCT GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTACGGGTACGCTGCTTGTCGATTCAGATCTTAA TGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGATTGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTA TTAGTGATATGTACGACCCTAAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGT GGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTA TAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTG GATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACA AATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTC TTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAG TTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAG TCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTG ACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCAT GCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGC TTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTG TTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCAC AAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCA GCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTT ATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTG GTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGA TTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATA ATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTC ACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTAC AAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCA ACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAA TTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGG GCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACA ATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGA GATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACA ATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATG CACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTA ACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTAC TGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACAC CAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCA GATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGC TGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATT CTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCT TACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAA GACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTT GTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAA CAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAG CAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATT GCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACA GATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGC ATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACC AAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGA AAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAAT TTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCA GACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCT ACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCC TCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTG CCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAA AGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGT CAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATA CATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTC AATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCC ATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTT GCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAA GGAGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGAATCTTCACAATTGGAACTGTAACTTTGAAG CAAGGTGAAATCAAGGATGCTACTCCTTCAGATTTTGTTCGCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTT CGGATGGCTTATTGTTGGCGTTGCACTTCTTGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGC AACTAGCACTCTCCAAGGGTGTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTC GTTGCTGCTGGCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAAT AATAATGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTTCTTTGCTGGC ATACTAATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTACTTCAGGTGATGGCACAACA AGTCCTATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATGGGAATCTGGAGTAAAAGACTGTGTTGTATT ACACAGTTACTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCT TCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTT AATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGA ACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTAT TCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTA AAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAAACGAACTA AATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCT TAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATG CCAACAGGAATAGGTTTTTGTATATAATTAAGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTG CTTGCTGCTGTTTACAGAATAAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCT CAGCTACTTCATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTC TCAACGTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGTGATCCTTCGT GGACATCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAAGAAATCACTGTTGCTACATC ACGAACGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTGACTCAGGTTTTGCTGCATACAGTCGCTACA GGATTGGCAACTATAAATTAAACACAGACCATTCCAGTAGCAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACA GATGTTTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTT GGAATCTTGATTACATCATAAACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGAT GAAGAGCAACCAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGA GCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACATACGAGGGCA ATTCACCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAATTTGCTTTTGCTTGTCCTGAC GGCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACTGTTCATCAGACAAGAGGAAGTTCAAGAACT TTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTTATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGAT TGAACTTTCATTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTT GGTTCTCACTTGAACTGCAAGATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATC ATCACAACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCC GTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAATTGTGCGTGG ATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCTGTTTACCTTTTACAATTAAT TGCCAGGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGAAGACTTTTTAGAGTATCATGACGTTCGTGT TGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTAC GTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCC AAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGA CAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGG TGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCT ATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGC AATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAG CAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTA GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAG CTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAA GAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC AAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCC AGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGC CATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACAT TCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAG CAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTC AACTCAGGCCTAAACTCATGCAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATA GTCTACTCTTGTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCT TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGT ACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCAT GTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Click to Show/Hide

References
1	Genome-wide bioinformatic analyses predict key host and viral factors in SARS-CoV-2 pathogenesis. Commun Biol. 2021 May 17;4(1):590.
2	Computational Mapping of the Human-SARS-CoV-2 Protein-RNA Interactome. bioRxiv. 2021 Dec; DOI:.org/10.1101/2021.12.22.472458.
3	RNA-Protein Interaction Analysis of SARS-CoV-2 5 and 3 Untranslated Regions Reveals a Role of Lysosome-Associated Membrane Protein-2a during Viral Infection. mSystems. 2021 Aug 31;6(4):e0064321.

Details of Virus RNA

Cite CovInter

About CovInter

Correspondence