Details of Virus RNA

 Virus RNA General Information
  Strain Information Strain Name
hCoV-19/Wuhan-Hu-1/2019
Strain Family
Beta (B.1.351)
GISAID Accession EPI_ISL_402125    Info 
Collection Date: 2019/12/31
Originating Lab: National Institute for Communicable Disease Control and Prevention (ICDC) Chinese Center for Disease Control and Prevention (China CDC)
Submitting Lab: National Institute for Communicable Disease Control and Prevention (ICDC) Chinese Center for Disease Control and Prevention (China CDC)
Authors: Zhang, Y.-Z., Wu, F., Chen, Y.-M., Pei, Y.-Y., Xu, L., Wang, W., Zhao, S., Yu, B., Hu, Y., Tao, Z.-W., Song, Z.-G., Tian, J.-H., Zhang, Y.-L., Liu, Y., Zheng, J.-J., Dai, F.-H., Wang, Q.-M., She, J.-L. and Zhu, T.-Y.
 EPI_SET ID EPI_SET_220823ya
Strain Mutation Site
P71L; T205I; K1655N; D80A; D215G; K417N; A701V; N501Y; E484K
RNA Binding Site
5'-UTR
  Virus Information Virus Name
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
Taxonomy ID 2697049

Virus RNA - Host Protein Network
  Regulation Network
  Network Download  
  Full list of proteins interacting with the 5'-UTR of this Strain
           Polyadenylate-binding protein 1 (PABPC1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Polypyrimidine tract-binding protein (PTBP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Heterogeneous nuclear ribonucleoprotein L (LGALS4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Heterogeneous nuclear ribonucleoprotein K (HNRNPK)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           ELAV-like protein 1 (ELAVL1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           140 kDa nucleolar phosphoprotein (Nopp140)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 39
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           39S ribosomal protein L40 (L40mt)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 49
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           60S acidic ribosomal protein P0 (XRN2)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           60S ribosomal protein L8 (ACTR2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 120
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           ADAM-TS 9 (FITM2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Adenine nucleotide translocator 4 (ANT 4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 60
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           AF4/FMR2 family member 1 (AF-4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 17
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Alpha-protein kinase 2 (HAK)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Anti-Zuai-1 (AZU-1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 20
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Antigen KI-67 messenger RNA (MKI67)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 20
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           APOBEC1 complementation factor (ACF)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Armadillo repeat-containing protein 2 (ARMC2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 14
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           ATP-binding cassette transporter A4 (ABCA4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 28
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           AU-rich element RNA-binding factor (HNRPDL)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 165
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Bloom syndrome protein (RECQ2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 27
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           BRCA1-associated protein (BRAP2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 32
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           C-1-tetrahydrofolate synthase (C1-THF synthase)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 372
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           C-C chemokine receptor type 7 (CCR7)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           cAMP-regulated phosphoprotein 19 (ARPP-19)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 26
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Caseinolytic peptidase B protein homolog (CLPB)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 22
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Cell proliferation-inducing gene 54 protein (PDS5A)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Chromodomain-helicase-DNA-binding protein 1 (CHD1L)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 24
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Chromodomain-helicase-DNA-binding protein 2 (CHD-2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 22
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Chromosome-associated polypeptide C (SMC4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 20
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Cingulin-like protein 1 (CGNL1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 33
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Coiled-coil domain-containing protein 6 (CCDC6)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 35
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Coiled-coil domain-containing protein 66 (PLA2G4A)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 17
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Craniofacial development protein 1 (CFDP1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 38
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           CUGBP Elav-like family member 2 (CELF2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           CUGBP Elav-like family member 4 (CELF4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           CUGBP Elav-like family member 5 (CELF5)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           CUGBP Elav-like family member 6 (CELF6)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Cyclin-dependent kinase 14 (CDK14)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 22
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Cyclin-T2 (CCNT2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 24
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Cytoskeleton-associated protein 2 (CKAP2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 63
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           DEAD box protein 59 (DDX59)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Dedicator of cytokinesis protein 2 (DOCK2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 18
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Dedicator of cytokinesis protein 3 (DOCK3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Dephospho-CoA kinase (DPCK)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 36
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Deubiquitinating enzyme FAF-Y (USP9Y)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           DNA mismatch repair protein Msh6 (MSH6)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 52
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           DNA [cytosine-5]-methyltransferase 1 (DNMT1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 30
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           E1A-binding protein p400 (EP400)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           E3 ubiquitin-protein ligase DTX3L (DTX3L)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 18
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           E3 ubiquitin-protein ligase TRIM71 (DIS3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 25
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           ELAV-like protein 2 (ELAVL2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           ESCRT-II complex subunit VPS22 (hVps22)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 104
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Eukaryotic translation initiation factor 5B (FITM1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 34
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Exosome complex exonuclease RRP44 (GPATCH1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 180
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           FK506-binding protein 4 (FKBP4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 40
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Formin-2 (FMN2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Formin-like protein 2 (FMNL2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 31
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           G patch domain-containing protein 1 (QRICH2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 22
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           G-rich sequence factor 1 (GRSF1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           G2 and S phase-expressed protein 1 (GTSE1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 54
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Gamma-butyrobetaine dioxygenase (GLYATL2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 31
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           GAP SH3 domain-binding protein 2 (G3BP2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 98
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           GAP-associated tyrosine phosphoprotein p62 (KHDRBS1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           General transcription factor IIF subunit 1 (GTF2F1)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Glutamine-rich protein 2 (GLG1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 31
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Glycine N-acyltransferase-like protein 2 (GRAMD4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 31
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Golgi apparatus protein 1 (HSPA1L)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 32
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Heat shock 70 kDa protein 1-like (ARHGAP23)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 492
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Heat shock protein HSP 90-alpha A2 (HNRNPCL2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 77
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Helicase-like transcription factor (HLTF)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Heparan-sulfate 6-O-sulfotransferase 3 (PCDHB16)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 37
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Heterogeneous nuclear ribonucleoprotein F (HNRNPF)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Heterogeneous nuclear ribonucleoprotein H (HNRNPH1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Heterogeneous nuclear ribonucleoprotein H2 (HNRNPH2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Heterogeneous nuclear ribonucleoprotein H3 (HNRNPH3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           hFXR2p (FXR2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           hFXR2p (FXR2)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Histone acetyltransferase (CBP)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 19
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Histone H3.1t (C1orf141)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 212
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           IGF2-binding protein 3 (IMP-3)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Integrin-linked protein kinase 1 (ILK)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 26
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Intracellular hyaluronan-binding protein 4 (HABP4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 41
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Iron-inhibited ABC transporter 2 (ABCF2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 70
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           ITI heavy chain H5 (ITI-HC5)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Kelch-like protein 20 (MFAP3L)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Kelch-like protein 35 (SPOUT1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 22
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Kinesin-like protein KIF13B (SREBF2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 30
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Kinetochore-associated protein 1 (KNTC1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Leucine-rich repeat-containing protein 44 (LRRIQ3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Lipoxygenase homology domain-containing protein 1 (LOXHD1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 31
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Long transient receptor potential channel 6 (TRPM6)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 32
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Long transient receptor potential channel 7 (TRPM7)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 32
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Lysine N-methyltransferase 3A (SETD2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 24
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Lysine-specific demethylase 5B (KDM5B)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Lysosome-associated membrane glycoprotein 2 (LAMP2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 119
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Membrane-associated guanylate kinase (MAGI3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Metabotropic glutamate receptor 7 (mGluR7)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Methyl-CpG-binding domain protein 4 (MBD4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 33
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Methyl-CpG-binding domain protein 5 (MBD5)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 30
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Microfibril-associated glycoprotein 3 (MFAP3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 24
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Microfibrillar-associated protein 3-like (ZNF257)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 24
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           mRNA decay activator protein ZFP36 (ZFP36)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Muscleblind-like protein 1 (MBNL1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Myb-binding protein 1A (NUGGC)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 32
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Myozenin-3 (MYOZ3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 17
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Nuclear GTPase SLIP-GC (H1-0)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 34
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Nuclear pore complex protein Nup133 (ANKRD19P)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 24
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Nuclear receptor-interacting protein 2 (NRIP2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 25
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Nuclear-associated protein SPAN-Xn3 (SPANX-N3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 19
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Nucleolar pre-rRNA processing protein NIP7 (KD93)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Nucleolar protein 16 (NOP16)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 35
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Nucleolysin TIAR (TIAL1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Nucleoporin like 2 (NUPL2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 35
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Nucleoprotein TPR (TPR)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 65
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Obg-like ATPase 1 (OLA1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 20
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Olfactory receptor 10AG1 (H1-2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 24
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           P2X purinoceptor 3 (P2RX3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 15
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Pannexin-2 (PANX2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 17
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Pappalysin-2 (ZNF397)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           PDHE1-A type I (KLHL35)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 60
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           PDZ and LIM domain protein 1 (SLITRK2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 36
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Peptidyl-prolyl cis-trans isomerase E (PPIE)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           PH and FYVE domain-containing protein 2 (Phafin2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 38
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Phospholipase A and acyltransferase 4 (HS6ST3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 19
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Phospholipase C-beta-4 (PLC-beta-4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 15
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Phospholipid-transporting ATPase IC (PROS1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           PI3-kinase beta (PIK3CB)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 15
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Plasma membrane calcium ATPase isoform 1 (PMCA1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 34
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Poly(rC)-binding protein 1
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Poly(rC)-binding protein 2
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Polyadenylate-binding protein 2 (PABPN1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Polyadenylate-binding protein 4-like (RPS6KB2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 27
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           PP2A subunit A isoform PR65-beta (MYBBP1A)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 27
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Pre-mRNA-processing-splicing factor 8 (PRPF8)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 36
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Pre-mRNA-splicing factor RBM22 (RBM22)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Prohibitin-2 (DDX39B)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 132
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Proline-rich acidic protein 1 (PRAP1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 20
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Proline-rich synapse-associated protein 2 (PDHA1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Protein CDV3 homolog (CDV3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 41
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Protein DBF4 homolog A (TUBA1C)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 18
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Protein FAM83H (TUBA1A)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 32
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Protein Shroom4 (LOXHD1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 20
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Protocadherin beta-16 (ZNF592)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 15
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Putative ankyrin repeat domain-containing protein 19 (KIAA1143)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Putative male-specific lethal-3 protein-like 2 (LRRIQ3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 31
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Putative microRNA 17 host gene protein (RABGEF1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 14
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Putative uncharacterized protein RPP38-DT (RASGRP3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 17
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Rab3-GAP150 (MKI67)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Ran GTPase-activating protein 1 (ATP10D)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 49
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Ran-binding protein 2-like 2 (RGPD2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 18
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           RanBP2-like and GRIP domain-containing protein 3 (RGPD3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 26
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           RanBP2-like and GRIP domain-containing protein 4 (RGPD4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 26
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           RANBP2-like and GRIP domain-containing protein 5/6 (RGPD5)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 26
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Ras guanyl-releasing protein 3 (SNRNP200)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 24
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           RAS protein activator like-3 (C18orf21)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 17
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Ras-interacting protein 1 (TMEM132B)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 21
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Regulator of G-protein signaling 3 (RGS3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Replication factor C subunit 1 (RFC1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 22
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Rho GTPase-activating protein 21 (SQOR)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 41
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Rho guanine nucleotide exchange factor 2 (C7orf25)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 18
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Ribonuclease 4 inhibitor (RNS4I)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 79
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           RNA binding protein fox-1 homolog 1 (RBFOX1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           RNA helicase aquarius (AQR)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           RNA polymerase II-associated protein 3 (RPAP3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 34
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           RNA-binding protein 24 (RBM24)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           RNA-binding protein 5 (G15)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           RNA-binding protein FUS (FUS)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           RNA-binding protein Nova-1 (NOVA1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Sam68-like mammalian protein 2 (SLM-2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Serine protease inhibitor Kazal-type 5 (UTP3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 31
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Serine/arginine-rich splicing factor 1 (SRSF1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Serine/arginine-rich splicing factor 10 (SRSF10)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Serine/arginine-rich splicing factor 2 (SRSF2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Serine/arginine-rich splicing factor 5 (SRSF5)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Serine/arginine-rich splicing factor 6 (SRSF6)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Serine/arginine-rich splicing factor 7 (SRSF7)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Serine/arginine-rich splicing factor 9 (SRSF9)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Serine/threonine-protein kinase B-raf (BRAF)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Similar to dipeptidyl aminopeptidase-like protein (DPP10)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 29
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           SLIT and NTRK-like protein 2 (FYTTD1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 21
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Sodium/iodide cotransporter (SLC5A5)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Something about silencing protein 10 (ATP10B)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 41
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Spermatid perinuclear RNA-binding protein (STRBP)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 20
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           splicing factor (PSF)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Splicing factor 3B subunit 4 (SF3B4)
              Protein Details Pro Info Click to show the detail information of this Protein [2]
              Infection Cells HepG2 cells (hepatocellular carcinoma cell line)  (CVCL_0027 )
              Cell Originated Tissue Liver
              Interaction Type Potential binding protein
              Description of Detection Method ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm
           Src substrate cortactin (PAPPA2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 70
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           SREBP transcription factor 2 (SREBF2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Stathmin-2 (STMN2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 49
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           STMN1 messenger RNA (STMN1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 49
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Stress-induced-phosphoprotein 1 (STIP1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 52
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Striatin (STRN)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 19
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Synaptic functional regulator FMR1 (FMR1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Syntrophin-associated serine/threonine-protein kinase (MAST1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 18
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           T-box brain protein 1 (TBR1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 22
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           T-cell activation GTPase-activating protein (TAGAP)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 26
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           T-cell-restricted intracellular antigen-1 (TIA-1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           TATA element modulatory factor (TMF1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 30
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Thioredoxin domain-containing protein 9 (ARHGAP21)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 28
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           THO complex subunit 2 (THOC2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 26
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Thyroid receptor-interacting protein 11 (PDLIM1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 28
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Trace amine-associated receptor 2 (TAAR2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 56
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           TRAF3-interacting protein 1 (SLC5A5)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 18
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Transcription termination factor 2 (TTF2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 48
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Translocon-associated protein subunit beta (SSR2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 39
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Transmembrane channel-like protein 1 (TMC1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 26
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Transmembrane protein 132B (RASIP1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Transmembrane protein 38B (ZNF629)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 15
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Trimethylguanosine synthase (TGS1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 20
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Triple homeobox protein 1 (ZHX3)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 33
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Tubulin alpha-1C chain (KCNK10)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 557
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Tyrosine-protein kinase Mer (MERTK)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           U5 snRNP-specific 200 kDa protein (RANGAP1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 61
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Uncharacterized protein C1orf141 (SLC17A6)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 35
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Uncharacterized protein C6orf201 (MAP3K20)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 30
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Uncharacterized protein KIAA0408 (CTTN)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           UPF0711 protein C18orf21 (KLHL20)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 25
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Vesicle protein sorting 35 (VPS35)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 19
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Vigilin (ATP2B1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 46
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Vitamin K-dependent protein S (NUP133)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 35
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           WD40 repeat-containing protein SMU1 (SMU1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           WDR67 protein (WDR67)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 15
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Y-box-binding protein 1 (YBX1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           YTH domain-containing protein 1 (YTHDC1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Zinc finger protein 257 (PIK3CB)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 28
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Zinc finger protein 265 (ZRANB2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Zinc finger protein 273 (DBF4)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Zinc finger protein 347 (H3C15)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 23
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Zinc finger protein 397 (RACK1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 18
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Zinc finger protein 506 (GNB2L1)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Zinc finger protein 638 (ZNF638)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Interaction Type Potential binding protein
              Description of Detection Method ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package
           Zinc finger protein 680 (HSP90AB2P)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Zinc finger protein 711 (PRSS3P2)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 21
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Zinc finger protein 92 (ZNF92)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)
           Zinc finger protein 93 (ZNF93)
              Protein Details Pro Info Click to show the detail information of this Protein [3]
              Infection Time 48 h
              Infection Cells HEK293 Cells (Human embryonic kidney cell)  (CVCL_0045 )
              Cell Originated Tissue Liver
              Interaction Score Prot score = 16
              Description of Detection Method RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS)

Virus RNA Sequence Information (Source: GISAID)
>hCoV-19/Wuhan/Hu-1/2019|EPI_ISL_402125|2019-12-31 ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAA AATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGG ACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGC CTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACAT CTTAAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAA ACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAG AACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGA TCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACG GAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTA GCACGTGCTGGTAAAGCTTCATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCG TGAACATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAAT TGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAA CCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCACCAAATGAATG CAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCAGACGGGCGATTTTGTTAAAG CCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAAATGCTGTT GTTAAAATTTATTGTCCAGCATGTCACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGG CTTGAAAACCATTCTTCGTAAGGGTGGTCGCACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACA AGTGTGCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGT CTTAATGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGA GATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGATTATAAAGCAT TCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAGGTGCCTGGAATATTGGTGAA CAGAAATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCGTGTTGTACGATCAATTTTCTCCCGCACTCT TGAAACTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCCGCTATAACAATACTAGATGGAATTTCACAGTATTCACTGA GACTCATTGATGCTATGATGTTCACATCTGATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTT GTTCAGTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGA AGAGAAGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAA TTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGTAAATAAATTT TTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTAGGTGAAACATTTGTCACGCA CTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCCTACTCATGCCTCTAAAAGCCCCAAAAGAAA TTATCTTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTTAACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCA TTAGAACAACCTACTAGTGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGA AATCAAAGACACAGAAAAGTACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTG CACCAACAAAGGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTT GATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAAATGAGTTCGC CTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACCACTGGGCATTGATTTAGATG AGTGGAGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAATTGGCTTCACATATGTATTGTTCTTTCTAC CCTCCAGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAGAAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGA AGATGATTACCAAGGTAAACCTTTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATT GGTTAGATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATT GTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTT AAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAACCAACAGTGGTTGTTA ATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTACTAACAATGCCATGCAAGTT GAATCTGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAA ACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTA ATCAGCACGAAGTTCTACTTGCACCATTATTATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGT GTAGATACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGA AATGAAGAGTGAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTA AACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAA ACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCAGATTCTGCCACTCTTGTTAG TGACATTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTG TGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTAT ATAACCACTTACCCGGGTCAGGGTTTAAATGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGC CTTTTACATTCTACCATCTATTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGC TTGCACATGCAGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAA TATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAACAACTGTAGC GTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTATGTAACACATGGCTTAAATT TGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCG TATAATGGTTATCTTACTTCTTCTTCTAAAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAA AGATTGGTCCTATTCTGGACAATCTACACAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTA GTAATCCTACCACATTCCACCTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTG AGGACTATTAAGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACA ACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGTAAAACATTTT ATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTGATCCTAGTTTTCTGGGTAGG TACATGTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAA CAACTGTTATCTTGCCACTGCATTGTTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTT ATTACAGAGCAAGGGCTGGTGAAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTA GGTGATGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTG TAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAAT TTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTCACCTTTTGTT ATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGTGAGTACACTGGTAATTACCA GTGTGGTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAAT ACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGTTACACAACAACCATAAAACCAGTTACTTATAAATTGGAT GGTGTTGTTTGTACAGAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAAT TGATCTTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTG ATGATTTAAACCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGT GATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAACCTATTGTTTG GCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTGTCTTTGGAGCACAAAACCAG TTGAAACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAA CCAGTCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGT AGGAGACATTATACTTAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTT ATGTAGACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCAT GGTTTAGCTGCTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTAC AACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTATTGCTACAAT TGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAGCAAAGAATACTGTTAAGAGT GTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTATAATTTG GTTTTTACTATTAAGTGTTTGCCTAGGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCA TGCCTTCTTACTGTACTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCT ATACCTTGTAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTC ATCTTTTAAATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCT ATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTCTTGGCTTATG TGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATCTTCTTTGCATCATTTTATTA TGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAA CAAGAGTCGAATGTACAACTATTGTTAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGC AAACTACACAATTGGAATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGA CTTGTCACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATG GTTCCATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC AACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAATGTGAAGAATC ATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACTAGATCAGGCATTAGTGTCTG ATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCA ATGGAAAAACTCAAAACACTAGTTGCAACTGCAGAAGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTAC TTTTATTTCAGCAGCTCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCAC ATCAATCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCC CGTGACCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGAT ATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAGAATAACTTAC CTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAGCACTTAAGGGTGGTAAAATT GTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACC TGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTG ACATAGCATCTACAGATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTAT ACTAATGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCAC GATATTACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACAC CATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTTTAAAGATGCT TCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTATGAAAGTTTACGCCCTGACAC ACGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTT TTGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTA CTTAACAATGATTATTACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTAC ACCACTAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACAT GCCTTGCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTC CTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTTACTTGTACTT GACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTTCACACCTTTAGTACCTTTCT GGATAACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTA GTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAA GTTGCGTAGTGATGTGCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTG GAGCAATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGT TCTGATGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCC ATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTTGATGACGTAG TTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAGATTTACTCATTCGTAAGTCT AATCATAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCT TAAGGTTGATACAGCCAATCCTAAGACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAG CTTGTTACAATGGTTCACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAAT GGTTCATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAAC TGGAGTTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTA CGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTTTCTCAATCGA TTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTAACACAAGACCATGTTGACAT ACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAATGGTA TGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGT GTTACTTTCCAAAGTGCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTT AGTTTTAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTA TTGCTATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCC ACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATATGGTTGATAC TAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACTAATCCTTATGACAGCAAGAA CTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAAT GCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCAT GTTTTTGGCCAGAGGTATTGTTTTTATGTGTGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTA TAATGCTAGTTTATTGTTTCTTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGA CTGACTCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAA GAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTAGCCACTGTAC AGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCATCT AAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAAAGATACTACTGAAGCCTTTGAAAAAATGGT TTCACTACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTAGACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGG CAACCTTACAAGCTATAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAG CAGGCTGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGA CCGTGATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTG AGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAATGATGCACTC AACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACAACAGCAGCCAAACTAATGGT TGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACATTTACTTATGCATCAGCATTGTGGGAAATCC AACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAGTGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCT CTTATTGTAACAGCTTTAAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGAT GTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTA GGTTTGTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATC TATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTATACTTTATTAA AGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCTACAAGCTGGTAATGCAACAG AAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCT AGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACC GGAAGCCAATATGGATCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATC CTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTT AAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCA GTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAG TACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTT GTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTAC CAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGA CGGTGACATGGTACCACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATT TTGATGAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAG GACTGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTT AAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAAGATCTCAATG GTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTG TTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAA GTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACAT ACCACCCAAATTGTGTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTG TTCCCACCTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCA CTTCAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGT ATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTCAGTAGCTGCA CTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGG TTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATG ACTACTATCGTTATAATCTACCAACAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTT GATTGTTACGATGGTGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAA TAAATGGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTA ATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC TCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAGGAGCTACTGT AGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTAGAAAACCCTCACC TTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGC AAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGT CATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTT TTAACATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTC CGCAATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGC ATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTATGCATCTCAAG GTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGG ACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGT GTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACAC TTATGATTGAACGGTTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTC TTTCATTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCT TACTAATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTG TTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTTATGTTGTAAA TGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTATGTTTGCAATGCTCCAGGTTG TGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATTGTAAATCACATAAACCACCCATTAGTTTTC CATTGTGTGCTAATGGACAAGTTTTTGGTTTATATAAAAATACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCA ATTGCAACATGTGACTGGACAAATGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGC AGAAACGCTCAAAGCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAG AATTACATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACT AAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACCGAGGTACAAC AACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATTAAGTGCACCTACACTAGTGC CACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATCTCAGATGAGTTTTCTAGCAATGTTGCAAAT TATCAAAAGGTTGGTATGCAAAAGTATTCTACACTCCAGGGACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCT AGCTCTCTACTACCCTTCTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCAT TAAAATATTTGCCTATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTG AATTCAACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGA AATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTACATTGGCGACC CTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTT ATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTT GGTTTATGATAATAAGCTTAAAGCACATAAAGACAAATCAGCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGC ATGATGTTTCATCTGCAATTAACAGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAA GCTGTCTTTATTTCACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTC ATCACAGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTA ATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTTGCAATTTACA AGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGT AATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTG ACATACCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAAT GGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTG TCATGCTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTAC CTACAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAA CACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAAGTGACACACT TAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATCTATGAAGTATTTTGTGAAAA TAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGG CATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACA AAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAG CTGTCCACGAGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCG GCTTGTAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAA CCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGTGACAAAGCTT ATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTGTATGCCTATTTTGGAATTGC AATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTG TGATGGTGGCAGTTTGTATGTAAATAAACATGCATTCCACACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAAC AATTACCATTTTTCTATTACTCTGACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCA CTAAAGTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTA TCTCGATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGA ACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGGACAACAGGGT GAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTAGAATTGTTTGAAAATAAAAC AACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTAAACCAGTACCAGAGGTGAAAATACTCAATA ATTTGGGTGTGGACATTGCTGCTAATACTGTGATCTGGGACTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGT GTTTGTTCTATGACTGACATAGCCAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGT TGATGGTCAAGTAGACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCAT CTGTAGGTCCCAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAG AAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTAAACCCAGGAG TCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATTAGAAGGCTATGCCTTCGAAC ATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAA TCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTACAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTC ATCTAAGTGTGTGTGTTCTGTTATTGATTTATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAG TTTCTAAGGTTGTCAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACA TTTTACCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCT ATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTCGCAAAATATA CTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTATACATTTTGGTGCTGGTTCT GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTACGGGTACGCTGCTTGTCGATTCAGATCTTAA TGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGATTGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTA TTAGTGATATGTACGACCCTAAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGT GGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTA TAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTG GATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACA AATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTC TTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAG TTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAG TCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTG ACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCAT GCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGC TTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTG TTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCAC AAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCA GCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTT ATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTG GTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGA TTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATA ATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTC ACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTAC AAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCA ACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAA TTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGG GCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACA ATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGA GATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACA ATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATG CACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTA ACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTAC TGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACAC CAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCA GATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGC TGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATT CTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCT TACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAA GACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTT GTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAA CAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAG CAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATT GCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACA GATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGC ATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACC AAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGA AAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAAT TTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCA GACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCT ACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCC TCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTG CCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAA AGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGT CAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATA CATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTC AATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCC ATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTT GCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAA GGAGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGAATCTTCACAATTGGAACTGTAACTTTGAAG CAAGGTGAAATCAAGGATGCTACTCCTTCAGATTTTGTTCGCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTT CGGATGGCTTATTGTTGGCGTTGCACTTCTTGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGC AACTAGCACTCTCCAAGGGTGTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTC GTTGCTGCTGGCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAAT AATAATGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTTCTTTGCTGGC ATACTAATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTACTTCAGGTGATGGCACAACA AGTCCTATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATGGGAATCTGGAGTAAAAGACTGTGTTGTATT ACACAGTTACTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCT TCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTT AATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGA ACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTAT TCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTA AAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAAACGAACTA AATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCT TAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATG CCAACAGGAATAGGTTTTTGTATATAATTAAGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTG CTTGCTGCTGTTTACAGAATAAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCT CAGCTACTTCATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTC TCAACGTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGTGATCCTTCGT GGACATCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAAGAAATCACTGTTGCTACATC ACGAACGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTGACTCAGGTTTTGCTGCATACAGTCGCTACA GGATTGGCAACTATAAATTAAACACAGACCATTCCAGTAGCAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACA GATGTTTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTT GGAATCTTGATTACATCATAAACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGAT GAAGAGCAACCAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGA GCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACATACGAGGGCA ATTCACCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAATTTGCTTTTGCTTGTCCTGAC GGCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACTGTTCATCAGACAAGAGGAAGTTCAAGAACT TTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTTATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGAT TGAACTTTCATTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTT GGTTCTCACTTGAACTGCAAGATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATC ATCACAACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCC GTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAATTGTGCGTGG ATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCTGTTTACCTTTTACAATTAAT TGCCAGGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGAAGACTTTTTAGAGTATCATGACGTTCGTGT TGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTAC GTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCC AAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGA CAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGG TGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCT ATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGC AATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAG CAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTA GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAG CTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAA GAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC AAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCC AGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGC CATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACAT TCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAG CAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTC AACTCAGGCCTAAACTCATGCAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATA GTCTACTCTTGTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCT TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGT ACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCAT GTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    Click to Show/Hide
References
1 Genome-wide bioinformatic analyses predict key host and viral factors in SARS-CoV-2 pathogenesis. Commun Biol. 2021 May 17;4(1):590.
2 Computational Mapping of the Human-SARS-CoV-2 Protein-RNA Interactome. bioRxiv. 2021 Dec; DOI:.org/10.1101/2021.12.22.472458.
3 RNA-Protein Interaction Analysis of SARS-CoV-2 5 and 3 Untranslated Regions Reveals a Role of Lysosome-Associated Membrane Protein-2a during Viral Infection. mSystems. 2021 Aug 31;6(4):e0064321.