Details of Virus RNA
Virus RNA General Information | |||||||||
---|---|---|---|---|---|---|---|---|---|
Strain Information | Strain Name |
hCoV-19/Wuhan-Hu-1/2019
|
|||||||
Strain Family |
Beta (B.1.351)
|
||||||||
GISAID Accession |
EPI_ISL_402125
Info
Collection Date: 2019/12/31
Originating Lab: National Institute for Communicable Disease Control and Prevention (ICDC) Chinese Center for Disease Control and Prevention (China CDC)
Submitting Lab: National Institute for Communicable Disease Control and Prevention (ICDC) Chinese Center for Disease Control and Prevention (China CDC)
Authors: Zhang, Y.-Z., Wu, F., Chen, Y.-M., Pei, Y.-Y., Xu, L., Wang, W., Zhao, S., Yu, B., Hu, Y., Tao, Z.-W., Song, Z.-G., Tian, J.-H., Zhang, Y.-L., Liu, Y., Zheng, J.-J., Dai, F.-H., Wang, Q.-M., She, J.-L. and Zhu, T.-Y.
|
EPI_SET ID | EPI_SET_220823ya | ||||||
Strain Mutation Site |
P71L; T205I; K1655N; D80A; D215G; K417N; A701V; N501Y; E484K
|
||||||||
RNA Binding Site |
5'-UTR
|
||||||||
Virus Information | Virus Name |
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
|
|||||||
Taxonomy ID | 2697049 |
Virus RNA - Host Protein Network | |||||||||
---|---|---|---|---|---|---|---|---|---|
Regulation Network | |||||||||
Full list of proteins interacting with the 5'-UTR of this Strain | |||||||||
---|---|---|---|---|---|---|---|---|---|
Polyadenylate-binding protein 1 (PABPC1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Polypyrimidine tract-binding protein (PTBP1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Heterogeneous nuclear ribonucleoprotein L (LGALS4) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Heterogeneous nuclear ribonucleoprotein K (HNRNPK) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC) | |||||||||
Protein Details |
Pro Info
![]() |
[2] | |||||||
Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
ELAV-like protein 1 (ELAVL1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
140 kDa nucleolar phosphoprotein (Nopp140) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 39 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
39S ribosomal protein L40 (L40mt) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 49 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
60S acidic ribosomal protein P0 (XRN2) | |||||||||
Protein Details |
Pro Info
![]() |
[2] | |||||||
Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
60S ribosomal protein L8 (ACTR2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 120 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
ADAM-TS 9 (FITM2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Adenine nucleotide translocator 4 (ANT 4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 60 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
AF4/FMR2 family member 1 (AF-4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 17 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Alpha-protein kinase 2 (HAK) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Anti-Zuai-1 (AZU-1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 20 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Antigen KI-67 messenger RNA (MKI67) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 20 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
APOBEC1 complementation factor (ACF) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Armadillo repeat-containing protein 2 (ARMC2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 14 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
ATP-binding cassette transporter A4 (ABCA4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 28 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
AU-rich element RNA-binding factor (HNRPDL) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 165 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Bloom syndrome protein (RECQ2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 27 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
BRCA1-associated protein (BRAP2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 32 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
C-1-tetrahydrofolate synthase (C1-THF synthase) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 372 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
C-C chemokine receptor type 7 (CCR7) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
cAMP-regulated phosphoprotein 19 (ARPP-19) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 26 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Caseinolytic peptidase B protein homolog (CLPB) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 22 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Cell proliferation-inducing gene 54 protein (PDS5A) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Chromodomain-helicase-DNA-binding protein 1 (CHD1L) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 24 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Chromodomain-helicase-DNA-binding protein 2 (CHD-2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 22 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Chromosome-associated polypeptide C (SMC4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 20 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Cingulin-like protein 1 (CGNL1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 33 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Coiled-coil domain-containing protein 6 (CCDC6) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 35 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Coiled-coil domain-containing protein 66 (PLA2G4A) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 17 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Craniofacial development protein 1 (CFDP1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 38 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
CUGBP Elav-like family member 2 (CELF2) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
CUGBP Elav-like family member 4 (CELF4) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
CUGBP Elav-like family member 5 (CELF5) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
CUGBP Elav-like family member 6 (CELF6) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Cyclin-dependent kinase 14 (CDK14) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 22 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Cyclin-T2 (CCNT2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 24 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Cytoskeleton-associated protein 2 (CKAP2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 63 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
DEAD box protein 59 (DDX59) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Dedicator of cytokinesis protein 2 (DOCK2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 18 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Dedicator of cytokinesis protein 3 (DOCK3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Dephospho-CoA kinase (DPCK) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 36 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Deubiquitinating enzyme FAF-Y (USP9Y) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
DNA mismatch repair protein Msh6 (MSH6) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 52 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
DNA [cytosine-5]-methyltransferase 1 (DNMT1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 30 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
E1A-binding protein p400 (EP400) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
E3 ubiquitin-protein ligase DTX3L (DTX3L) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 18 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
E3 ubiquitin-protein ligase TRIM71 (DIS3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 25 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
ELAV-like protein 2 (ELAVL2) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
ESCRT-II complex subunit VPS22 (hVps22) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 104 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Eukaryotic translation initiation factor 5B (FITM1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 34 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Exosome complex exonuclease RRP44 (GPATCH1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 180 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
FK506-binding protein 4 (FKBP4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 40 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Formin-2 (FMN2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Formin-like protein 2 (FMNL2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 31 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
G patch domain-containing protein 1 (QRICH2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 22 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
G-rich sequence factor 1 (GRSF1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
G2 and S phase-expressed protein 1 (GTSE1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 54 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Gamma-butyrobetaine dioxygenase (GLYATL2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 31 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
GAP SH3 domain-binding protein 2 (G3BP2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 98 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
GAP-associated tyrosine phosphoprotein p62 (KHDRBS1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
General transcription factor IIF subunit 1 (GTF2F1) | |||||||||
Protein Details |
Pro Info
![]() |
[2] | |||||||
Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
Glutamine-rich protein 2 (GLG1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 31 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Glycine N-acyltransferase-like protein 2 (GRAMD4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 31 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Golgi apparatus protein 1 (HSPA1L) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 32 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Heat shock 70 kDa protein 1-like (ARHGAP23) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 492 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Heat shock protein HSP 90-alpha A2 (HNRNPCL2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 77 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Helicase-like transcription factor (HLTF) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Heparan-sulfate 6-O-sulfotransferase 3 (PCDHB16) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 37 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Heterogeneous nuclear ribonucleoprotein F (HNRNPF) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Heterogeneous nuclear ribonucleoprotein H (HNRNPH1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Heterogeneous nuclear ribonucleoprotein H2 (HNRNPH2) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Heterogeneous nuclear ribonucleoprotein H3 (HNRNPH3) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
hFXR2p (FXR2) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
hFXR2p (FXR2) | |||||||||
Protein Details |
Pro Info
![]() |
[2] | |||||||
Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
Histone acetyltransferase (CBP) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 19 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Histone H3.1t (C1orf141) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 212 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
IGF2-binding protein 3 (IMP-3) | |||||||||
Protein Details |
Pro Info
![]() |
[2] | |||||||
Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
Integrin-linked protein kinase 1 (ILK) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 26 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Intracellular hyaluronan-binding protein 4 (HABP4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 41 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Iron-inhibited ABC transporter 2 (ABCF2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 70 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
ITI heavy chain H5 (ITI-HC5) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Kelch-like protein 20 (MFAP3L) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Kelch-like protein 35 (SPOUT1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 22 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Kinesin-like protein KIF13B (SREBF2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 30 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Kinetochore-associated protein 1 (KNTC1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Leucine-rich repeat-containing protein 44 (LRRIQ3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Lipoxygenase homology domain-containing protein 1 (LOXHD1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 31 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Long transient receptor potential channel 6 (TRPM6) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 32 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Long transient receptor potential channel 7 (TRPM7) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 32 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Lysine N-methyltransferase 3A (SETD2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 24 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Lysine-specific demethylase 5B (KDM5B) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Lysosome-associated membrane glycoprotein 2 (LAMP2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 119 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Membrane-associated guanylate kinase (MAGI3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Metabotropic glutamate receptor 7 (mGluR7) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Methyl-CpG-binding domain protein 4 (MBD4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 33 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Methyl-CpG-binding domain protein 5 (MBD5) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 30 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Microfibril-associated glycoprotein 3 (MFAP3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 24 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Microfibrillar-associated protein 3-like (ZNF257) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 24 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
mRNA decay activator protein ZFP36 (ZFP36) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Muscleblind-like protein 1 (MBNL1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Myb-binding protein 1A (NUGGC) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 32 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Myozenin-3 (MYOZ3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 17 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Nuclear GTPase SLIP-GC (H1-0) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 34 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Nuclear pore complex protein Nup133 (ANKRD19P) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 24 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Nuclear receptor-interacting protein 2 (NRIP2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 25 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Nuclear-associated protein SPAN-Xn3 (SPANX-N3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 19 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Nucleolar pre-rRNA processing protein NIP7 (KD93) | |||||||||
Protein Details |
Pro Info
![]() |
[2] | |||||||
Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
Nucleolar protein 16 (NOP16) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 35 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Nucleolysin TIAR (TIAL1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Nucleoporin like 2 (NUPL2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 35 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Nucleoprotein TPR (TPR) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 65 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Obg-like ATPase 1 (OLA1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 20 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Olfactory receptor 10AG1 (H1-2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 24 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
P2X purinoceptor 3 (P2RX3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 15 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Pannexin-2 (PANX2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 17 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Pappalysin-2 (ZNF397) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
PDHE1-A type I (KLHL35) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 60 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
PDZ and LIM domain protein 1 (SLITRK2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 36 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Peptidyl-prolyl cis-trans isomerase E (PPIE) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
PH and FYVE domain-containing protein 2 (Phafin2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 38 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Phospholipase A and acyltransferase 4 (HS6ST3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 19 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Phospholipase C-beta-4 (PLC-beta-4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 15 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Phospholipid-transporting ATPase IC (PROS1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
PI3-kinase beta (PIK3CB) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 15 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Plasma membrane calcium ATPase isoform 1 (PMCA1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 34 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Poly(rC)-binding protein 1 | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Poly(rC)-binding protein 2 | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Polyadenylate-binding protein 2 (PABPN1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Polyadenylate-binding protein 4-like (RPS6KB2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 27 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
PP2A subunit A isoform PR65-beta (MYBBP1A) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 27 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Pre-mRNA-processing-splicing factor 8 (PRPF8) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 36 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Pre-mRNA-splicing factor RBM22 (RBM22) | |||||||||
Protein Details |
Pro Info
![]() |
[2] | |||||||
Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
Prohibitin-2 (DDX39B) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 132 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Proline-rich acidic protein 1 (PRAP1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 20 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Proline-rich synapse-associated protein 2 (PDHA1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Protein CDV3 homolog (CDV3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 41 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Protein DBF4 homolog A (TUBA1C) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 18 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Protein FAM83H (TUBA1A) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 32 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Protein Shroom4 (LOXHD1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 20 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Protocadherin beta-16 (ZNF592) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 15 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Putative ankyrin repeat domain-containing protein 19 (KIAA1143) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Putative male-specific lethal-3 protein-like 2 (LRRIQ3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 31 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Putative microRNA 17 host gene protein (RABGEF1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 14 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Putative uncharacterized protein RPP38-DT (RASGRP3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 17 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Rab3-GAP150 (MKI67) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Ran GTPase-activating protein 1 (ATP10D) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 49 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Ran-binding protein 2-like 2 (RGPD2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 18 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
RanBP2-like and GRIP domain-containing protein 3 (RGPD3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 26 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
RanBP2-like and GRIP domain-containing protein 4 (RGPD4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 26 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
RANBP2-like and GRIP domain-containing protein 5/6 (RGPD5) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 26 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Ras guanyl-releasing protein 3 (SNRNP200) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 24 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
RAS protein activator like-3 (C18orf21) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 17 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Ras-interacting protein 1 (TMEM132B) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 21 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Regulator of G-protein signaling 3 (RGS3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Replication factor C subunit 1 (RFC1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 22 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Rho GTPase-activating protein 21 (SQOR) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 41 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Rho guanine nucleotide exchange factor 2 (C7orf25) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 18 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Ribonuclease 4 inhibitor (RNS4I) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 79 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
RNA binding protein fox-1 homolog 1 (RBFOX1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
RNA helicase aquarius (AQR) | |||||||||
Protein Details |
Pro Info
![]() |
[2] | |||||||
Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
RNA polymerase II-associated protein 3 (RPAP3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 34 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
RNA-binding protein 24 (RBM24) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
RNA-binding protein 5 (G15) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
RNA-binding protein FUS (FUS) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
RNA-binding protein Nova-1 (NOVA1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Sam68-like mammalian protein 2 (SLM-2) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Serine protease inhibitor Kazal-type 5 (UTP3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 31 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Serine/arginine-rich splicing factor 1 (SRSF1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Serine/arginine-rich splicing factor 10 (SRSF10) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Serine/arginine-rich splicing factor 2 (SRSF2) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Serine/arginine-rich splicing factor 5 (SRSF5) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Serine/arginine-rich splicing factor 6 (SRSF6) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Serine/arginine-rich splicing factor 7 (SRSF7) | |||||||||
Protein Details |
Pro Info
![]() |
[2] | |||||||
Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
Serine/arginine-rich splicing factor 9 (SRSF9) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Serine/threonine-protein kinase B-raf (BRAF) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Similar to dipeptidyl aminopeptidase-like protein (DPP10) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 29 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
SLIT and NTRK-like protein 2 (FYTTD1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 21 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Sodium/iodide cotransporter (SLC5A5) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Something about silencing protein 10 (ATP10B) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 41 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Spermatid perinuclear RNA-binding protein (STRBP) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 20 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
splicing factor (PSF) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Splicing factor 3B subunit 4 (SF3B4) | |||||||||
Protein Details |
Pro Info
![]() |
[2] | |||||||
Infection Cells | HepG2 cells (hepatocellular carcinoma cell line) (CVCL_0027 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ENCODE project database; Pysster model; DeepRiPe (Section 3.6; 3.7; 3.8; 3.9); ClustalO (72) algorithm | ||||||||
Src substrate cortactin (PAPPA2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 70 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
SREBP transcription factor 2 (SREBF2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Stathmin-2 (STMN2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 49 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
STMN1 messenger RNA (STMN1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 49 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Stress-induced-phosphoprotein 1 (STIP1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 52 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Striatin (STRN) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 19 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Synaptic functional regulator FMR1 (FMR1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Syntrophin-associated serine/threonine-protein kinase (MAST1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 18 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
T-box brain protein 1 (TBR1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 22 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
T-cell activation GTPase-activating protein (TAGAP) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 26 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
T-cell-restricted intracellular antigen-1 (TIA-1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
TATA element modulatory factor (TMF1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 30 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Thioredoxin domain-containing protein 9 (ARHGAP21) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 28 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
THO complex subunit 2 (THOC2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 26 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Thyroid receptor-interacting protein 11 (PDLIM1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 28 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Trace amine-associated receptor 2 (TAAR2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 56 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
TRAF3-interacting protein 1 (SLC5A5) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 18 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Transcription termination factor 2 (TTF2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 48 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Translocon-associated protein subunit beta (SSR2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 39 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Transmembrane channel-like protein 1 (TMC1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 26 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Transmembrane protein 132B (RASIP1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Transmembrane protein 38B (ZNF629) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 15 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Trimethylguanosine synthase (TGS1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 20 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Triple homeobox protein 1 (ZHX3) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 33 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Tubulin alpha-1C chain (KCNK10) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 557 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Tyrosine-protein kinase Mer (MERTK) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
U5 snRNP-specific 200 kDa protein (RANGAP1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 61 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Uncharacterized protein C1orf141 (SLC17A6) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 35 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Uncharacterized protein C6orf201 (MAP3K20) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 30 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Uncharacterized protein KIAA0408 (CTTN) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
UPF0711 protein C18orf21 (KLHL20) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 25 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Vesicle protein sorting 35 (VPS35) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 19 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Vigilin (ATP2B1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 46 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Vitamin K-dependent protein S (NUP133) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 35 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
WD40 repeat-containing protein SMU1 (SMU1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
WDR67 protein (WDR67) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 15 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Y-box-binding protein 1 (YBX1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
YTH domain-containing protein 1 (YTHDC1) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Zinc finger protein 257 (PIK3CB) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 28 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Zinc finger protein 265 (ZRANB2) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Zinc finger protein 273 (DBF4) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Zinc finger protein 347 (H3C15) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 23 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Zinc finger protein 397 (RACK1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 18 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Zinc finger protein 506 (GNB2L1) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Zinc finger protein 638 (ZNF638) | |||||||||
Protein Details |
Pro Info
![]() |
[1] | |||||||
Interaction Type | Potential binding protein | ||||||||
Description of Detection Method | ATtRACT Database; Position Weight Matrices (PWMs); TFBSTools R package | ||||||||
Zinc finger protein 680 (HSP90AB2P) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Zinc finger protein 711 (PRSS3P2) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 21 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Zinc finger protein 92 (ZNF92) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) | ||||||||
Zinc finger protein 93 (ZNF93) | |||||||||
Protein Details |
Pro Info
![]() |
[3] | |||||||
Infection Time | 48 h | ||||||||
Infection Cells | HEK293 Cells (Human embryonic kidney cell) (CVCL_0045 ) | ||||||||
Cell Originated Tissue | Liver | ||||||||
Interaction Score | Prot score = 16 | ||||||||
Description of Detection Method | RNA-protein interaction detection (RaPID) assay; liquid chromatography with tandem mass spectrometry (LC-MS/MS) |
Virus RNA Sequence Information (Source: GISAID) |
>hCoV-19/Wuhan/Hu-1/2019|EPI_ISL_402125|2019-12-31
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAA
AATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGG
ACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT
CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGC
CTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACAT
CTTAAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAA
ACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC
GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAG
AACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGA
TCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACG
GAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTA
GCACGTGCTGGTAAAGCTTCATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCG
TGAACATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAAT
TGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAA
CCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCACCAAATGAATG
CAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCAGACGGGCGATTTTGTTAAAG
CCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAAATGCTGTT
GTTAAAATTTATTGTCCAGCATGTCACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGG
CTTGAAAACCATTCTTCGTAAGGGTGGTCGCACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACA
AGTGTGCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGT
CTTAATGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGA
GATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGATTATAAAGCAT
TCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAGGTGCCTGGAATATTGGTGAA
CAGAAATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCGTGTTGTACGATCAATTTTCTCCCGCACTCT
TGAAACTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCCGCTATAACAATACTAGATGGAATTTCACAGTATTCACTGA
GACTCATTGATGCTATGATGTTCACATCTGATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTT
GTTCAGTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGA
AGAGAAGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAA
TTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGTAAATAAATTT
TTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTAGGTGAAACATTTGTCACGCA
CTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCCTACTCATGCCTCTAAAAGCCCCAAAAGAAA
TTATCTTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTTAACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCA
TTAGAACAACCTACTAGTGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGA
AATCAAAGACACAGAAAAGTACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTG
CACCAACAAAGGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTT
GATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAAATGAGTTCGC
CTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACCACTGGGCATTGATTTAGATG
AGTGGAGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAATTGGCTTCACATATGTATTGTTCTTTCTAC
CCTCCAGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAGAAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGA
AGATGATTACCAAGGTAAACCTTTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATT
GGTTAGATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATT
GTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTT
AAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAACCAACAGTGGTTGTTA
ATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTACTAACAATGCCATGCAAGTT
GAATCTGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAA
ACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTA
ATCAGCACGAAGTTCTACTTGCACCATTATTATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGT
GTAGATACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGA
AATGAAGAGTGAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTA
AACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAA
ACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCAGATTCTGCCACTCTTGTTAG
TGACATTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTG
TGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTAT
ATAACCACTTACCCGGGTCAGGGTTTAAATGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGC
CTTTTACATTCTACCATCTATTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGC
TTGCACATGCAGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAA
TATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAACAACTGTAGC
GTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTATGTAACACATGGCTTAAATT
TGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCG
TATAATGGTTATCTTACTTCTTCTTCTAAAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAA
AGATTGGTCCTATTCTGGACAATCTACACAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTA
GTAATCCTACCACATTCCACCTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTG
AGGACTATTAAGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACA
ACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGTAAAACATTTT
ATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTGATCCTAGTTTTCTGGGTAGG
TACATGTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAA
CAACTGTTATCTTGCCACTGCATTGTTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTT
ATTACAGAGCAAGGGCTGGTGAAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTA
GGTGATGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTG
TAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAAT
TTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTCACCTTTTGTT
ATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGTGAGTACACTGGTAATTACCA
GTGTGGTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAAT
ACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGTTACACAACAACCATAAAACCAGTTACTTATAAATTGGAT
GGTGTTGTTTGTACAGAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAAT
TGATCTTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTG
ATGATTTAAACCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGT
GATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAACCTATTGTTTG
GCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTGTCTTTGGAGCACAAAACCAG
TTGAAACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAA
CCAGTCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGT
AGGAGACATTATACTTAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTT
ATGTAGACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCAT
GGTTTAGCTGCTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTAC
AACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTATTGCTACAAT
TGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAGCAAAGAATACTGTTAAGAGT
GTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTATAATTTG
GTTTTTACTATTAAGTGTTTGCCTAGGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCA
TGCCTTCTTACTGTACTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCT
ATACCTTGTAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTC
ATCTTTTAAATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCT
ATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTCTTGGCTTATG
TGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATCTTCTTTGCATCATTTTATTA
TGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAA
CAAGAGTCGAATGTACAACTATTGTTAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGC
AAACTACACAATTGGAATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGA
CTTGTCACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATG
GTTCCATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC
AACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAATGTGAAGAATC
ATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACTAGATCAGGCATTAGTGTCTG
ATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCA
ATGGAAAAACTCAAAACACTAGTTGCAACTGCAGAAGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTAC
TTTTATTTCAGCAGCTCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCAC
ATCAATCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCC
CGTGACCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGAT
ATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAGAATAACTTAC
CTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAGCACTTAAGGGTGGTAAAATT
GTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACC
TGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTG
ACATAGCATCTACAGATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTAT
ACTAATGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCAC
GATATTACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACAC
CATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTTTAAAGATGCT
TCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTATGAAAGTTTACGCCCTGACAC
ACGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTT
TTGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTA
CTTAACAATGATTATTACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTAC
ACCACTAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACAT
GCCTTGCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTC
CTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTTACTTGTACTT
GACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTTCACACCTTTAGTACCTTTCT
GGATAACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTA
GTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAA
GTTGCGTAGTGATGTGCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTG
GAGCAATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGT
TCTGATGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCC
ATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTTGATGACGTAG
TTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAGATTTACTCATTCGTAAGTCT
AATCATAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCT
TAAGGTTGATACAGCCAATCCTAAGACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAG
CTTGTTACAATGGTTCACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAAT
GGTTCATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAAC
TGGAGTTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTA
CGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTTTCTCAATCGA
TTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTAACACAAGACCATGTTGACAT
ACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAATGGTA
TGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGT
GTTACTTTCCAAAGTGCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTT
AGTTTTAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTA
TTGCTATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCC
ACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATATGGTTGATAC
TAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACTAATCCTTATGACAGCAAGAA
CTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAAT
GCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCAT
GTTTTTGGCCAGAGGTATTGTTTTTATGTGTGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTA
TAATGCTAGTTTATTGTTTCTTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGA
CTGACTCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAA
GAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTAGCCACTGTAC
AGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCATCT
AAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAAAGATACTACTGAAGCCTTTGAAAAAATGGT
TTCACTACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTAGACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGG
CAACCTTACAAGCTATAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAG
CAGGCTGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGA
CCGTGATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTG
AGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAATGATGCACTC
AACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACAACAGCAGCCAAACTAATGGT
TGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACATTTACTTATGCATCAGCATTGTGGGAAATCC
AACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAGTGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCT
CTTATTGTAACAGCTTTAAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGAT
GTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTA
GGTTTGTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATC
TATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTATACTTTATTAA
AGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCTACAAGCTGGTAATGCAACAG
AAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCT
AGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACC
GGAAGCCAATATGGATCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATC
CTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTT
AAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCA
GTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAG
TACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTT
GTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTAC
CAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGA
CGGTGACATGGTACCACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATT
TTGATGAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAG
GACTGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTT
AAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAAGATCTCAATG
GTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTG
TTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAA
GTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACAT
ACCACCCAAATTGTGTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTG
TTCCCACCTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCA
CTTCAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGT
ATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTCAGTAGCTGCA
CTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGG
TTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATG
ACTACTATCGTTATAATCTACCAACAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTT
GATTGTTACGATGGTGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAA
TAAATGGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTA
ATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC
TCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAGGAGCTACTGT
AGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTAGAAAACCCTCACC
TTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGC
AAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGT
CATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTT
TTAACATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTC
CGCAATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGC
ATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTATGCATCTCAAG
GTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGG
ACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGT
GTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACAC
TTATGATTGAACGGTTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTC
TTTCATTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCT
TACTAATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTG
TTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTTATGTTGTAAA
TGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTATGTTTGCAATGCTCCAGGTTG
TGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATTGTAAATCACATAAACCACCCATTAGTTTTC
CATTGTGTGCTAATGGACAAGTTTTTGGTTTATATAAAAATACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCA
ATTGCAACATGTGACTGGACAAATGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGC
AGAAACGCTCAAAGCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAG
AATTACATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACT
AAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACCGAGGTACAAC
AACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATTAAGTGCACCTACACTAGTGC
CACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATCTCAGATGAGTTTTCTAGCAATGTTGCAAAT
TATCAAAAGGTTGGTATGCAAAAGTATTCTACACTCCAGGGACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCT
AGCTCTCTACTACCCTTCTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCAT
TAAAATATTTGCCTATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTG
AATTCAACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGA
AATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTACATTGGCGACC
CTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTT
ATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTT
GGTTTATGATAATAAGCTTAAAGCACATAAAGACAAATCAGCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGC
ATGATGTTTCATCTGCAATTAACAGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAA
GCTGTCTTTATTTCACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTC
ATCACAGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTA
ATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTTGCAATTTACA
AGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGT
AATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTG
ACATACCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAAT
GGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTG
TCATGCTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTAC
CTACAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAA
CACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAAGTGACACACT
TAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATCTATGAAGTATTTTGTGAAAA
TAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGG
CATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACA
AAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAG
CTGTCCACGAGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCG
GCTTGTAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAA
CCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGTGACAAAGCTT
ATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTGTATGCCTATTTTGGAATTGC
AATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTG
TGATGGTGGCAGTTTGTATGTAAATAAACATGCATTCCACACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAAC
AATTACCATTTTTCTATTACTCTGACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCA
CTAAAGTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTA
TCTCGATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGA
ACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGGACAACAGGGT
GAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTAGAATTGTTTGAAAATAAAAC
AACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTAAACCAGTACCAGAGGTGAAAATACTCAATA
ATTTGGGTGTGGACATTGCTGCTAATACTGTGATCTGGGACTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGT
GTTTGTTCTATGACTGACATAGCCAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGT
TGATGGTCAAGTAGACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCAT
CTGTAGGTCCCAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAG
AAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTAAACCCAGGAG
TCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATTAGAAGGCTATGCCTTCGAAC
ATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAA
TCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTACAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTC
ATCTAAGTGTGTGTGTTCTGTTATTGATTTATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAG
TTTCTAAGGTTGTCAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACA
TTTTACCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCT
ATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTCGCAAAATATA
CTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTATACATTTTGGTGCTGGTTCT
GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTACGGGTACGCTGCTTGTCGATTCAGATCTTAA
TGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGATTGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTA
TTAGTGATATGTACGACCCTAAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGT
GGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTA
TAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTG
GATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACA
AATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTC
TTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAG
TTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAG
TCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTG
ACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCAT
GCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGC
TTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTG
TTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCAC
AAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCA
GCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTT
ATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTG
GTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGA
TTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATA
ATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTC
ACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTAC
AAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCA
ACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAA
TTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGG
GCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACA
ATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGA
GATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACA
ATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATG
CACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTA
ACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTAC
TGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACAC
CAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCA
GATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGC
TGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATT
CTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCT
TACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAA
GACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTT
GTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAA
CAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAG
CAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATT
GCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACA
GATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGC
ATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACC
AAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGA
AAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAAT
TTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCA
GACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCT
ACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCC
TCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTG
CCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAA
AGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGT
CAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATA
CATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTC
AATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCC
ATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTT
GCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAA
GGAGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGAATCTTCACAATTGGAACTGTAACTTTGAAG
CAAGGTGAAATCAAGGATGCTACTCCTTCAGATTTTGTTCGCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTT
CGGATGGCTTATTGTTGGCGTTGCACTTCTTGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGC
AACTAGCACTCTCCAAGGGTGTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTC
GTTGCTGCTGGCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAAT
AATAATGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTTCTTTGCTGGC
ATACTAATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTACTTCAGGTGATGGCACAACA
AGTCCTATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATGGGAATCTGGAGTAAAAGACTGTGTTGTATT
ACACAGTTACTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCT
TCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTT
AATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGA
ACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTAT
TCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTA
AAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAAACGAACTA
AATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCT
TAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATG
CCAACAGGAATAGGTTTTTGTATATAATTAAGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTG
CTTGCTGCTGTTTACAGAATAAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCT
CAGCTACTTCATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTC
TCAACGTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGTGATCCTTCGT
GGACATCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAAGAAATCACTGTTGCTACATC
ACGAACGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTGACTCAGGTTTTGCTGCATACAGTCGCTACA
GGATTGGCAACTATAAATTAAACACAGACCATTCCAGTAGCAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACA
GATGTTTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTT
GGAATCTTGATTACATCATAAACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGAT
GAAGAGCAACCAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGA
GCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACATACGAGGGCA
ATTCACCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAATTTGCTTTTGCTTGTCCTGAC
GGCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACTGTTCATCAGACAAGAGGAAGTTCAAGAACT
TTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTTATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGAT
TGAACTTTCATTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTT
GGTTCTCACTTGAACTGCAAGATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATC
ATCACAACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCC
GTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAATTGTGCGTGG
ATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCTGTTTACCTTTTACAATTAAT
TGCCAGGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGAAGACTTTTTAGAGTATCATGACGTTCGTGT
TGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTAC
GTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCC
AAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGA
CAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGG
TGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCT
ATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGC
AATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAG
CAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTA
GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAG
CTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAA
GAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC
AAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCC
AGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGC
CATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACAT
TCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAG
CAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTC
AACTCAGGCCTAAACTCATGCAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATA
GTCTACTCTTGTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCT
TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGT
ACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCAT
GTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Click to Show/Hide
|
---|