Virus RNA General Information
  Strain Information Strain Name
hCoV-19/Not Specified Virus Strain
RNA Binding Site
Not Specified Virus Region
  Virus Information Virus Name
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
Taxonomy ID 2697049
GeneBank ID MN996528.1

Virus RNA - Host Protein Network
  Regulation Network
  Full list of proteins interacting with the Not Specified Virus Region of this Strain
           hnRNP A1 messenger RNA (HNRNPA1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.06787E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           IGF2-binding protein 1 (IMP-1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.02847E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Elongation factor 1-alpha 1 (EEF1A1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.32647E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           APOBEC1-binding protein 1 (HNRNPAB)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.02149E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Polyadenylate-binding protein 1 (PABPC1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.28233E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           hnRNP A2/B1 messenger RNA (HNRNPA2B1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.20428E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Heterogeneous nuclear ribonucleoprotein Q (SYNCRIP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.63383E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Nucleolin (NCL)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 528869943.2
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           130 kDa leucine-rich protein (LRP 130)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.26632E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           18 kDa phosphoprotein (p18)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.24439E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           3-mercaptopyruvate sulfurtransferase (MST)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.86924E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           40S ribosomal protein S11 (RPS10)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.86201E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           40S ribosomal protein S14 (RPS11)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.11238E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           40S ribosomal protein S15 (RPS14)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.41849E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           40S ribosomal protein S20 (RPS2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 6.55325E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           40S ribosomal protein S27-like (RPS26)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.26221E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           40S ribosomal protein S3a (RPS3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 7.8133E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           40S ribosomal protein S5 (RPS4X)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.06529E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           40S ribosomal protein S6 (RPS5)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.67774E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           60S ribosomal protein L13a (RPL13)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 7.48695E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           60S ribosomal protein L19 (RPL18A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.62656E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           60S ribosomal protein L22 (RPL21)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.49943E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           60S ribosomal protein L29 (RPL28)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.19872E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           60S ribosomal protein L30 (RPL3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.8425E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           60S ribosomal protein L4 (RPL36AL)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.68162E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           60S ribosomal protein L7 (RPL6)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.75863E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           60S ribosomal protein L9 (RPL8)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.3886E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Acetyl-CoA carboxylase 1 (ACC1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 6.34428E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Acetyl-CoA carboxylase 2 (ACACB)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.56512E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Actin, cytoplasmic 1 (ACTB)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.71103E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Actin-related protein 2 (ARP2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 8.76745E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Acyl-CoA synthetase short-chain family member 3 (ACSS3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.01344E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Adenylate kinase 4 (AK 4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.28137E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           AFG3-like protein 2 (AFG3L2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.10328E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Alanyl-tRNA synthetase (AlaRS)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.69167E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Alpha-actin-1 (ACTA)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.11393E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Alstrom syndrome protein 1 (KIAA0328)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.5088E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Amiloride-sensitive sodium channel subunit delta (ENaCD)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.77103E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           APOBEC1 complementation factor (ACF)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 5.31668E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Apolipoprotein E (APOE)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.93622E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Apoptotic chromatin condensation inducer in the nucleus (Acinus)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.64093E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Arginine/serine-rich coiled-coil protein 2 (RSRC2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.95163E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Ataxin-2-like protein (A2RP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.87115E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Bleomycin hydrolase (BH)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.02313E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Calgranulin B (S100A9)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.62049E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Calmodulin-like skin protein (CLSP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.16084E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Cationic trypsinogen (PRSS1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.60951E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Cellular nucleic acid-binding protein (CNBP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.81445E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           cidic nuclear phosphoprotein pp32 (pp32)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.99756E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Cold shock domain-containing protein E1 (CSDE1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 5.71456E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Contactin-associated protein-like 4 (CNTNAP4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.7238E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Corneodesmosin (CDSN)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.74141E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Corrinoid adenosyltransferase MMAB (MMAB)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.48659E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Cystatin-A (CSTA)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.83006E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Cytochrome c oxidase subunit 5A, mitochondrial (COX5A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.16176E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           DEAD box protein 39 (DDX39)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 5.91603E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           DNA repair protein XRCC6 (XRCC6)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.99097E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           DNA replication licensing factor MCM3 (MCM3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.87398E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Double-stranded RNA-specific adenosine deaminase (ADAR)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.19537E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           E3 ubiquitin-protein ligase RBBP6 (RBBP6)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 6.87766E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           E3 ubiquitin-protein ligase TRIM56 (TRIM56)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 5.53028E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           E3-binding protein (PDHX)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.22021E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           EBNA2 coactivator p100 (SND1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.49199E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           eIF-1A Y isoform (eIF-4C)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 8.77892E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           eIF-2-beta (EIF2S2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.66159E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Elongation factor 2 (EEF2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.25143E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Epidermal growth factor receptor (EGFR)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.84472E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Eukaryotic translation initiation factor 3 subunit C (EIF3C)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.16056E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Eukaryotic translation initiation factor 3 subunit E (EIF3E)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.38541E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Eukaryotic translation initiation factor 3 subunit G (EIF3G)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.10094E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Eukaryotic translation initiation factor 3 subunit H (EIF3H)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 8.5338E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Eukaryotic translation initiation factor 3 subunit I (EIF3I)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.18082E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Eukaryotic translation initiation factor 4B (EIF4B)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.33157E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Eukaryotic translation initiation factor 4H (EIF4H)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.82678E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Eukaryotic translation initiation factor 5A-1 (EIF5A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 7.24938E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Far upstream element-binding protein 3 (FUBP3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.19551E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Fatty acid-binding protein 5 (FABP5)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.65975E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Filamin A (FLNA)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.01729E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Filamin-B (FLNB)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 8.53217E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           G patch domain-containing protein 8 (GPATCH8)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.29921E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           GAP SH3 domain-binding protein 2 (G3BP2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.32286E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           General vesicular transport factor p115 (USO1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.45563E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Glutaminase kidney isoform, mitochondrial (GLS)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.99348E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Glycine amidinotransferase, mitochondrial (GATM)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.99639E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           GPI-anchored protein p137 (GPI-p137)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.1489E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Heat shock protein 75 kDa (TRAP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.66198E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Helicase MOV-10 (MOV10)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 5.45192E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Helicase-like protein 2 (HLP2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.19875E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Heterogeneous nuclear ribonucleoprotein A0 (HNRNPA0)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.42654E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 8.9413E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Histone H1.0 (SHANK3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 7.56726E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Histone H1.2 (ZBED9)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 9.13879E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Histone H1.5 (MIR17HG)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.39058E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Histone H1s-2 (H1.3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.52717E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Histone H2B type 2-F (TRAF3IP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.72373E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           HUMAN la-related protein 1 (LARP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.01006E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           IF-4-gamma 1 (EIF4G1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.26178E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           IGF2-binding protein 2 (IMP-2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.18004E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Inorganic pyrophosphatase 2, mitochondrial (PPA2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.38765E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Isovaleryl-CoA dehydrogenase (IVD)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.84021E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Junction plakoglobin (JUP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.09379E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Keratinocyte proline-rich protein (KPRP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.46435E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           La-related protein 4 (LARP4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.96066E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Large ribosomal subunit protein eL15 (RPL15)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.83793E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Leukophysin (LKP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.43074E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           LIM and SH3 domain protein 1 (LASP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.15867E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Lupus La protein (SSB)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 111356715.2
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           MCCase subunit beta (MCCC2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.92409E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Mitochondrial intermediate peptidase (MIPEP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.09732E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Mucin-like protein 1 (MUCL1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 5.37534E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Nucleolar RNA helicase 2 (DDX21)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 6.13963E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Nucleolus and neural progenitor protein (NEPRO)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 56733998.18
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Nucleophosmin (NPM1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.26883E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Oxalosuccinate decarboxylase (IDH1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.99294E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           PAI1 RNA-binding protein 1 (PAI-RBP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.41883E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Persulfide dioxygenase ETHE1 (ETHE1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.65372E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           PEX7-binding protein 2 (P7BP2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.88757E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Phosphatidylethanolamine-binding protein 1 (PEBP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.07357E+12
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Phosphatidylinositol-3-phosphatase SAC1 (IGHG1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.49633E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Phosphoglycerate kinase 1 (PGK1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.99619E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Phospholipase A2 inhibitory protein (PA2IP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.80573E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Pinin (PNN)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.99582E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Poly(rC)-binding protein 2
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.73028E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Polyadenylate-binding protein 4 (PABPC4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 8.78267E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Polypeptide GalNAc transferase 1 (GalNAc-T1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.01481E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Polypyrimidine tract-binding protein 3 (PTBP3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.91503E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           PP-1B (HNRNPUL2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 7.46165E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Pre-mRNA-processing factor 40 homolog A (PRPF40A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 8.7641E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Profilin-1 (PFN1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.66127E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Protein argonaute-1 (AGO1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.83181E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Protein kinase C inhibitor protein 1 (KCIP-1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.37645E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Protein lin-28 homolog B (LIN28B)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.16394E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Protein LSM14 homolog A (EPPK1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.77076E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Protein phosphatase 1C catalytic subunit (PPP1CC)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 6.65426E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Protein SON (SON)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.24202E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Protein transport protein Sec23A (SEC23A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.91884E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Pumilio homolog 1 (PUM1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.01006E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Pyruvate dehydrogenase complex component E2 (PDCE2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.331E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Ras-related protein Rab-6A (RAB6A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 6.9137E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Ras-related protein Rab-6D (RBMY1A1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 6.8548E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Ras-related protein Rab-7a (RAB7A)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.1656E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Regulator of nonsense transcripts 1 (NORF1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.81824E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Ribonuclease P protein subunit p20 (POP7)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.88003E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Ribonuclease P protein subunit p25 (RPP25)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 485065.4438
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Ribonuclease P protein subunit p29 (POP4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 572347.1885
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Ribonuclease P protein subunit p30 (RPP30)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 116813934.4
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Ribonucleases P/MRP protein subunit POP1 (POP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 263403.946
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           RNA-binding protein 47 (RBM47)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.11238E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           RNA-binding protein Musashi-2 (MSI2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.38971E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           RNA-splicing ligase RtcB homolog (RTCB)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.88722E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Rotamase A (PPIA)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 8.76745E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Sarcosine dehydrogenase, mitochondrial (SARDH)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.58417E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Sec1 family domain-containing protein 1 (SCFD1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 7.50486E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Serine/arginine repetitive matrix protein 2 (SRRM2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.44887E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Serpin B12 (SERPINB12)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.11069E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Serrate RNA effector molecule homolog (SRRT)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.94028E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Single-stranded DNA-binding protein (SSBP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.06757E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Small ribosomal subunit protein eS12 (RPS12)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.67139E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Sodium pump subunit alpha-1 (ATP1A1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.1193E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Splicing factor Prp43 (hPrp43)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.80654E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Stomatin (STOM)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.1705E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Stress-induced-phosphoprotein 1 (STIP1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.75785E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Suppressor of CDC2 with RNA-binding motif 3 (RBMS2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 5.62953E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Suprabasin (SBSN)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.39053E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           T-complex protein 1 subunit gamma (CCT3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.45467E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Talin messenger RNA (TLN1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.36113E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Thioredoxin-dependent peroxide reductase (PRDX3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.41967E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Threonine synthase-like 1 (THNSL1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 8.49943E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Titin (TTN)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.70824E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Transgelin-2 (TAGLN2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 3.17721E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Transglutaminase E (TGM3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.23587E+13
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Translocon-associated protein subunit delta (SSR4)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.57146E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           UNR-interacting protein (STRAP)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 2.13411E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Valacyclovir hydrolase (BPHL)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.43474E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           X-ray repair cross-complementing 5 (Ku80)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.68599E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Y-box-binding protein 1 (YBX1)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 4.35898E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           Y-box-binding protein 3 (YBX3)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 6.28552E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot
           YTH domain-containing family protein 2 (YTHDF2)
              Protein Details Pro Info Click to show the detail information of this Protein [1]
              Infection Time 24h
              Infection Cells Huh7 cells (liver carcinoma cell)  (CVCL_0336 )
              Cell Originated Tissue Liver
              Interaction Score log2FC = 1.15863E+14
              Description of Detection Method RNA antisense purification and quantitative mass spectrometry (RAP-MS); Tandem mass tag (TMT) labelling; liquid chromatography tandem mass spectrometry (LC-MS/MS); Westernblot

Virus RNA Sequence Information (Source: GeneBank)
>MN996528.1 Severe acute respiratory syndrome coronavirus 2 isolate WIV04, complete genome
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA CGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAAC TAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTG TTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTC CCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTAC GTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGG CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAT GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT TCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTA GGCGACGAGCTTGGCACTGATCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTG TTACCCGTGAACTCATGCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGG CCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACGTGCTGGTAAAGCTTCATGCACTTTG TCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAACATGAGCATGAAATTG CTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCAAAGAA ATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAA CCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCAC CAAATGAATGCAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCA GACGGGCGATTTTGTTAAAGCCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACT ACTTGTGGTTACTTACCCCAAAATGCTGTTGTTAAAATTTATTGTCCAGCATGTCACAATTCAGAAGTAG GACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGGCTTGAAAACCATTCTTCGTAAGGGTGGTCG CACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACAAGTGTGCCTATTGGGTTCCA CGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGTCTTAATGACA ACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGA GATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGAT TATAAAGCATTCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAG GTGCCTGGAATATTGGTGAACAGAAATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCG TGTTGTACGATCAATTTTCTCCCGCACTCTTGAAACTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCC GCTATAACAATACTAGATGGAATTTCACAGTATTCACTGAGACTCATTGATGCTATGATGTTCACATCTG ATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTTGTTCAGTTGACTTCGCAGTG GCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGAAGAGAAGTTT AAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAA TTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGT AAATAAATTTTTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTA GGTGAAACATTTGTCACGCACTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCC TACTCATGCCTCTAAAAGCCCCAAAAGAAATTATCTTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTT AACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCATTAGAACAACCTACTAGTGAAGCTGTTGAA GCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGAAATCAAAGACACAGAAAAGT ACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTGCACCAACAAA GGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTT GATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAA ATGAGTTCGCCTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACC ACTGGGCATTGATTTAGATGAGTGGAGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAA TTGGCTTCACATATGTATTGTTCTTTCTACCCTCCAGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAG AAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGAAGATGATTACCAAGGTAAACCTTTGGAATT TGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTAGATGATGATAGTCAA CAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTTGAGGTTC AACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTT AAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAACCAACA GTGGTTGTTAATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTA CTAACAATGCCATGCAAGTTGAATCTGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAG TTGTGTTTTAAGCGGACACAATCTTGCTAAACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGT GAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAATCAGCACGAAGTTCTACTTGCACCATTAT TATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGTGTAGATACTGTTCGCACAAA TGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGAAATGAAGAGT GAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTA AACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAAC TCTGGAAGAAACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCA GATTCTGCCACTCTTGTTAGTGACATTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTG ATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAAT GCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAACCACTTACCCGGGTCAGGGTTTAAAT GGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCCTTTTACATTCTACCATCTA TTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGCTTGCACATGC AGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAA TATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAA CAACTGTAGCGTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTA TGTAACACATGGCTTAAATTTGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTT TCTGTTTCTTCACCTGATGCTGTTACAGCGTATAATGGTTATCTTACTTCTTCTTCTAAAACACCTGAAG AACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAAAGATTGGTCCTATTCTGGACAATCTACACA ACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTAGTAATCCTACCACATTCCAC CTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTGAGGACTATTA AGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACA ACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGT AAAACATTTTATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTG ATCCTAGTTTTCTGGGTAGGTACATGTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAA TGGTTTAACTTCTATTAAATGGGCAGATAACAACTGTTATCTTGCCACTGCATTGTTAACACTCCAACAA ATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTACAGAGCAAGGGCTGGTGAAGCTGCTA ACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGATGTTAGAGAAACAAT GAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTGTAAAACTTGT GGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAAT TTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTC ACCTTTTGTTATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGT GAGTACACTGGTAATTACCAGTGTGGTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAG ACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAG TTACACAACAACCATAAAACCAGTTACTTATAAATTGGATGGTGTTGTTTGTACAGAAATTGACCCTAAG TTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAATTGATCTTGTACCAAACCAAC CATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTGATGATTTAAA CCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGT GATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAAC CTATTGTTTGGCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTG TCTTTGGAGCACAAAACCAGTTGAAACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGA ATGGATAATCTTGCCTGCGAAGATCTAAAACCAGTCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGA AAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAGACATTATACTTAAACCAGCAAATAA TAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTAGACAATTCTAGTCTT ACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCATGGTTTAGCTG CTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTAC AACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTA TTGCTACAATTGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAG CAAAGAATACTGTTAAGAGTGTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAA TTTTTCTAAACTGATAAATATTATAATTTGGTTTTTACTATTAAGTGTTTGCCTAGGTTCTTTAATCTAC TCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCTTCTTACTGTACTGGTTACAGAGAAG GCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACCTTGTAGTGTTTGTCT TAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTCATCTTTTAAA TGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCT ATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTC TTGGCTTATGTGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATC TTCTTTGCATCATTTTATTATGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTT GTATGATGTGTTACAAACGTAATAGAGCAACAAGAGTCGAATGTACAACTATTGTTAATGGTGTTAGAAG GTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAAACTACACAATTGGAATTGTGTTAATTGT GATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGTCACTACAGTTTAAAA GACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATGGTTCCATCCA TCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC AACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAAT GTGAAGAATCATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACT AGATCAGGCATTAGTGTCTGATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTT AATACGTTTTCATCAACTTTTAACGTACCAATGGAAAAACTCAAAACACTAGTTGCAACTGCAGAAGCTG AACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTTATTTCAGCAGCTCGGCAAGGGTTTGT TGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACATCAATCTGACATAGAAGTT ACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCCCGTGACCTTG GTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGAT ATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAG AATAACTTACCTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAG CACTTAAGGGTGGTAAAATTGTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTT TGTTGCTGCTATTTTCTATTTAATAACACCTGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAA ATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACATAGCATCTACAGATACTTGTTTTGCTA ACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTATACTAATGACAAAGCTTGCCC ATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCACGATATTACGC ACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACAC CATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTT TAAAGATGCTTCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTAT GAAAGTTTACGCCCTGACACACGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACC TTGAAGGTTCTGTTAGAGTGGTAACAACTTTTGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATC AGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTACTTAACAATGATTATTACAGATCTTTACCA GGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTACACCACTAATTCAACCTATTG GTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACATGCCTTGCCTA CTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTC CTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTT ACTTGTACTTGACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTT CACACCTTTAGTACCTTTCTGGATAACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGG TTCTTTAGTAATTACCTAAAGAGACGTGTAGTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTG CGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAAGTTGCGTAGTGATGTGCTATTACCTCTTAC GCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCAATGGATACAACTAGC TACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGTTCTGATGTTC TTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCC ATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTT GATGACGTAGTTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAG ATTTACTCATTCGTAAGTCTAATCATAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGG ACATTCTATGCAAAATTGTGTACTTAAGCTTAAGGTTGATACAGCCAATCCTAAGACACCTAAGTATAAG TTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAGCTTGTTACAATGGTTCACCATCTGGTGTTT ACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAATGGTTCATGTGGTAGTGTTGG TTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAACTGGAGTTCAT GCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTA CGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTT TCTCAATCGATTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTA ACACAAGACCATGTTGACATACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTG CTTCATTAAAAGAATTACTGCAAAATGGTATGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGA TGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGTGTTACTTTCCAAAGTGCAGTGAAAAGAACA ATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAGTTTTAGTCCAGAGTACTC AATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTATTGCTATGTC TGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCC ACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATA TGGTTGATACTAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACT AATCCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTG ACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCT CTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCATGTTTTTGGCCAGAGGTATTGTTTTTATGTG TGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTATAATGCTAGTTTATTGTTTC TTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGACTGACTCTTG GTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAA GAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTA GCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAAC TCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAA AGATACTACTGAAGCCTTTGAAAAAATGGTTTCACTACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTA GACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGGCAACCTTACAAGCTATAGCCTCAGAGTTTA GTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAGCAGGCTGTTGCTAATGGTGA TTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGACCGTGATGCA GCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTG AGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAA TGATGCACTCAACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACA ACAGCAGCCAAACTAATGGTTGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACAT TTACTTATGCATCAGCATTGTGGGAAATCCAACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAG TGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCTCTTATTGTAACAGCTTTAAGGGCCAATTCT GCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTA CACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTAGGTTTGTACT TGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATC TATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTAT ACTTTATTAAAGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCT ACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGAT GCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGT GTACACACACTGGTACTGGTCAGGCAATAACAGTTACACCGGAAGCCAATATGGATCAAGAATCCTTTGG TGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTA AAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAG TCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCA GTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCA CAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAA ATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTT GTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTC CAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTGACATGGTACCACATATATCACGTCA ACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGATGAAGGTAATTGTGAC ACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAGGACTGGTATG ATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTT AAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAA GATCTCAATGGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTG TAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGT TGACACTGACTTAACAAAGCCTTACATTAAGTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTA AAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCACCCAAATTGTGTTAACTGTTTGGATG ACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCCCACCTACAAGTTTTGG ACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCACTTCAGAGAG CTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGT ATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTC AGTAGCTGCACTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTAT GACTTTGCTGTGTCTAAGGGTTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTC AGGATGGTAATGCTGCTATCAGCGATTATGACTACTATCGTTATAATCTACCAACAATGTGTGATATCAG ACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTGTTACGATGGTGGCTGTATTAATGCT AACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAATGGGGTAAGGCTAGAC TTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTAATGTCATCCC TACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC TCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAG GAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAG TGATGTAGAAAACCCTCACCTTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTT AGAATTATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATA GATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACC AGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTC ACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGCAATTTAC AACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGC ATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTAT GCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTA TGTCTGAAGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATAC AATGCTAGTTAAACAGGGTGATGATTATGTGTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCC GGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATGATTGAACGGTTCGTGTCTTTAGCTA TAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTCATTTGTACTTACAATA CATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCTTACTAATGAT AACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTG TTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTT ATGTTGTAAATGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTAT GTTTGCAATGCTCCAGGTTGTGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATT GTAAATCACATAAACCACCCATTAGTTTTCCATTGTGTGCTAATGGACAAGTTTTTGGTTTATATAAAAA TACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCAATTGCAACATGTGACTGGACAAATGCTGGT GATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGCAGAAACGCTCAAAGCTACTG AGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAGAATTACATCT TTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACT AAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACC GAGGTACAACAACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATT AAGTGCACCTACACTAGTGCCACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATC TCAGATGAGTTTTCTAGCAATGTTGCAAATTATCAAAAGGTTGGTATGCAAAAGTATTCTACACTCCAGG GACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCTAGCTCTCTACTACCCTTCTGCTCGCATAGT GTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCATTAAAATATTTGCCTATAGAT AAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTGAATTCAACAT TAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGA AATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTAC ATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATT TCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCC TGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGATAATAAGCTTAAAGCACATAAAGACAAATCA GCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGCATGATGTTTCATCTGCAATTAACAGGCCAC AAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAAGCTGTCTTTATTTCACCTTA TAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTCATCACAGGGC TCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTA ATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTT GCAATTTACAAGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTC TTTAAAGATTGTAGTAAGGTAATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACA CTAAATTCAAAACTGAAGGTTTATGTGTTGACATACCTGGCATACCTAAGGACATGACCTATAGAAGACT CATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACATGTTTATCACCCGCGAA GAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTGTCATGCTACTAGAGAAGCTG TTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTACCTACAGGTTA TGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAA CACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAA GTGACACACTTAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATC TATGAAGTATTTTGTGAAAATAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTT TCCACTGCTTCAGACACTTATGCCTGTTGGCATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTA TGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCA TGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTCCACGAGTGCTTTGTT AAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCGGCTTGTAGAA AGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAA CCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGT GACAAAGCTTATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTG TATGCCTATTTTGGAATTGCAATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAG AGTGCTATCTAACCTTAACTTGCCTGGTTGTGATGGTGGCAGTTTGTATGTAAATAAACATGCATTCCAC ACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAACAATTACCATTTTTCTATTACTCTGACAGTC CATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCACTAAAGTCTGCTACGTGTAT AACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTATCTCGATGCT TATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGA ACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGG ACAACAGGGTGAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTA GAATTGTTTGAAAATAAAACAACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTA AACCAGTACCAGAGGTGAAAATACTCAATAATTTGGGTGTGGACATTGCTGCTAATACTGTGATCTGGGA CTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGTGTTTGTTCTATGACTGACATAGCCAAGAAA CCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGTTGATGGTCAAGTAGACTTAT TTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCATCTGTAGGTCC CAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAG AAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTA AACCCAGGAGTCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATT AGAAGGCTATGCCTTCGAACATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTA CTGATTGGACTAGCTAAACGTTTTAAGGAATCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTA CAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTCATCTAAGTGTGTGTGTTCTGTTATTGATTT ATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAGTTTCTAAGGTTGTCAAAGTG ACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACATTTTACCCAA AATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCT ATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTC GCAAAATATACTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTA TACATTTTGGTGCTGGTTCTGATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTAC GGGTACGCTGCTTGTCGATTCAGATCTTAATGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGAT TGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTATTAGTGATATGTACGACCCTAAGACTAAAA ATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCT AGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATG GGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTG GATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTG GAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTA AGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAG GTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAA CAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCA ATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCA GTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATG TCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGC TTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCC CTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCAT TTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGC GAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTC AAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTA TTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTAT TAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCA GGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATA ATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTT GAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATT GTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTG TTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATC ATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTAT GCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTG ATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTC TAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGA GATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACT TTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACT TTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAAC AAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTC TGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGA GATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAAC CAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTA CTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGC TGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACT CAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTG GTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTAC CACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCA ACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAA TAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACC AATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCA TTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATT GCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACC TTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGG ACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTG GAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAA AATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCA CAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATA TCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTTCAAAG TTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCT ACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTA TGTCCTTCCCTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAA GAACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTT TCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACA CATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACC TGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCACCAGATGTTGATTTA GGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTG CCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCC ATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGT ATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACG ACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGA ATCTTCACAATTGGAACTGTAACTTTGAAGCAAGGTGAAATCAAGGATGCTACTCCTTCAGATTTTGTTC GCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTTCGGATGGCTTATTGTTGGCGTTGCACTTCT TGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGCAACTAGCACTCTCCAAGGGT GTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTCGTTGCTGCTG GCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAAT AATAATGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTT CTTTGCTGGCATACTAATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTA CTTCAGGTGATGGCACAACAAGTCCTATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATG GGAATCTGGAGTAAAAGACTGTGTTGTATTACACAGTTACTTCACTTCAGACTATTACCAGCTGTACTCA ACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCTTCTTCATCTACAATAAAATTGTTGATGAGC CTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAAT TTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTAC TCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTAT TCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGT GAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGAT CTTCTGGTCTAAACGAACTAAATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGA TTCCAACGGTACTATTACCGTTGAAGAGCTTAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTC CTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATGCCAACAGGAATAGGTTTTTGTATATAATTA AGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTGCTTGCTGCTGTTTACAGAAT AAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCTCAGCTACTTC ATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTC TCAACGTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGT GATCCTTCGTGGACATCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAA GAAATCACTGTTGCTACATCACGAACGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTG ACTCAGGTTTTGCTGCATACAGTCGCTACAGGATTGGCAACTATAAATTAAACACAGACCATTCCAGTAG CAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACAGATGTTTCATCTCGTTGACTTTCAGGTTAC TATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTTGGAATCTTGATTACATCATA AACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGATGAAGAGCAAC CAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGA GCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACA TACGAGGGCAATTCACCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAAT TTGCTTTTGCTTGTCCTGACGGCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACT GTTCATCAGACAAGAGGAAGTTCAAGAACTTTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTT ATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGATTGAACTTTCATTAATTGACTTCTATTTGTG CTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTTGGTTCTCACTTGAACTGCAA GATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATCATCACAACTG TAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCC GTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAA TTGTGCGTGGATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCT GTTTACCTTTTACAATTAATTGCCAGGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGA AGACTTTTTAGAGTATCATGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTG ATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAG TAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACT GCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTC CAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGG TGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCT GGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAA AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAAC ATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGT AGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCA ATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGG TAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGG CAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC AAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACA ATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACG TGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGC TGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGC TGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGAT TTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCTAAACTCATG CAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATAGTCTACTCTT GTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCT TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTAC GATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAAT TTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAA A
    Click to Show/Hide
References
1 The SARS-CoV-2 RNA-protein interactome in infected human cells. Nat Microbiol. 2021 Mar;6(3):339-353.