Details of Virus RNA

Virus RNA General Information
Strain Information	Strain Name	hCoV-19/USA/WA1/2020
	Strain Family	Alpha (B.1.1.7)
	GISAID Accession	EPI_ISL_404895 Info Collection Date: 2020/1/19 Originating Lab: Providence Regional Medical Center Submitting Lab: Division of Viral Diseases, Centers for Disease Control and Prevention Authors: Queen, K., Tao, Y., Li, Y., Paden, C.R., Lu, X., Zhang, J., Gerber, S.I., Lindstrom, S., Tong, S.	EPI_SET ID	EPI_SET_220823ya
	Strain Mutation Site	T1001I; A1708D; I2230T; N501Y; A570D; P681H; T716I; S982A; D1118H; Q27*; R52I; Y73C; D3L; S235F
	RNA Binding Site	Not Specified Virus Region
Virus Information	Virus Name	Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
Virus Information	Taxonomy ID	2697049

Virus RNA - Host Protein Network
Regulation Network
Regulation Network		Network Download

Full list of proteins interacting with the Not Specified Virus Region of this Strain
*hnRNP A1 messenger RNA (HNRNPA1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*IGF2-binding protein 1 (IMP-1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Elongation factor 1-alpha 1 (EEF1A1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Eukaryotic initiation factor 4A-I (EIF4A1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*APOBEC1-binding protein 1 (HNRNPAB)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Polyadenylate-binding protein 1 (PABPC1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Polypyrimidine tract-binding protein (PTBP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*hnRNP A2/B1 messenger RNA (HNRNPA2B1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Spliceosome RNA helicase DDX39B (EXOSC6)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein L (LGALS4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein K (HNRNPK)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein Q (SYNCRIP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein U (HNRNPU)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*ELAV-like protein 1 (ELAVL1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Nucleolin (NCL)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*14-3-3 protein theta (HS1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*18 kDa phosphoprotein (p18)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*26S proteasome regulatory subunit RPN1 (TRAP2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*26S proteasome regulatory subunit RPN11 (POH1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*26S proteasome regulatory subunit RPN5 (PSMD12)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*26S proteasome regulatory subunit RPN9 (PSMD13)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*26S proteasome regulatory subunit S10 (p42A)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*26S proteasome subunit S5B (KIAA0072)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*40S ribosomal protein S15 (RPS14)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*40S ribosomal protein S18 (H4C1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*40S ribosomal protein S20 (RPS2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*40S ribosomal protein S27-like (RPS26)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*40S ribosomal protein S3a (RPS3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*40S ribosomal protein S4, X isoform (RPS3A)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*40S ribosomal protein S5 (RPS4X)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*60S ribosomal protein L13a (RPL13)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*60S ribosomal protein L26 (RPL24)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*60S ribosomal protein L9 (RPL8)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Acetyl-CoA transferase-like protein (ACTL)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Adenosylhomocysteinase (AHCY)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Adenylosuccinate lyase (ADSL)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*ADP-ribosylation factor 4 (ARF2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Alcohol dehydrogenase 5 (FALDH)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Aldehyde dehydrogenase 1A1 (ALHDII)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*ALG-2-interacting protein 1 (PDCD6IP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Alpha-actinin-4 (ACTN4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Annexin A5 (ANXA5)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Antisecretory factor 1 (ASF)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*AP endonuclease 1 (APEX1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*AP-3 adaptor complex mu3A subunit (AP3M1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*APC-binding protein EB1 (EB1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*ASF/SF2-associated protein p32 (C1QBP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*ATP-citrate synthase (ACLY)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*ATP-dependent RNA helicase A (DHX9)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*ATP-dependent RNA helicase DDX5 (DDX5)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*AU-rich element RNA-binding protein 1 (AUF1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Calponin-3 (CNN3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Cellular nucleic acid-binding protein (CNBP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Clathrin heavy chain on chromosome 17 (CLH-17)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Cleavage factor Im complex 59 kDa subunit (CFIm59)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Cleavage stimulation factor 64 kDa subunit (CstF-64)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Cleavage stimulation factor subunit 3 (CstF-77)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Coatomer subunit beta (p102)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Cold shock domain-containing protein E1 (CSDE1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Coronin-1B (CORO1B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Creatine kinase B-type (CKB)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Cullin-associated NEDD8-dissociated protein 1 (CAND1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Cytosolic non-specific dipeptidase (CNDP2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Cytovillin (EZR)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*D-fructose-6-phosphate amidotransferase 1 (GFPT1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*DAZ-associated protein 1 (DAZAP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*DBIRD complex subunit ZNF326 (ZNF326)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*DEAD box protein 17 (DDX17)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*DEAD box protein 19A (DDX19L)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*DEAD box protein 39 (DDX39)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*DEAD box protein 6 (DDX6)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Deleted in breast cancer gene 1 protein (DBC-1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*DRG family-regulatory protein 1 (ZC3H15)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*E1B-55 kDa-associated protein 5 (E1B-AP5)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*EBNA2 coactivator p100 (SND1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*eIF-2-alpha (EIF2S1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*eIF-2-gamma X (EIF2S3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*eIF-3-eta (EIF3B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*eIF5-mimic protein 2 (BZW1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Ester hydrolase C11orf54 (C11orf54)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Eukaryotic initiation factor 4A-III (EIF4A3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Eukaryotic release factor 1 (ETF1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Eukaryotic translation initiation factor 3 subunit F (EIF3F)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Eukaryotic translation initiation factor 3 subunit I (EIF3I)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Eukaryotic translation initiation factor 4B (EIF4B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Eukaryotic translation initiation factor 4H (EIF4H)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Extracellular signal-regulated kinase 2 (ERK2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Ezrin-radixin-moesin-binding phosphoprotein 50 (EBP50)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*F-actin-capping protein subunit alpha-1 (CAPZA1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*F-actin-capping protein subunit beta (CAPZB)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Far upstream element-binding protein 1 (FUBP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Far upstream element-binding protein 2 (KHSRP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Far upstream element-binding protein 3 (FUBP3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Fatty acid synthase (FASN)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Fatty acid-binding protein 1 (FABP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Flap endonuclease 1 (FEN1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*GAP SH3 domain-binding protein 1 (G3BP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*GAP SH3 domain-binding protein 2 (G3BP2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*GAP-associated tyrosine phosphoprotein p62 (KHDRBS1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*General vesicular transport factor p115 (USO1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Glucose-6-phosphate isomerase (GPI)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Glutathione reductase (GR)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Glutathione S-transferase P (GSTP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Glycoprotein p43 (RBMX)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*GTP-binding nuclear protein Ran (RAN)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heat shock 70 kDa protein 4 (HSPA4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heat shock protein 20 (HSP20)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heat shock protein 40 (HSP40)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Helicase MOV-10 (MOV10)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Helicase-like protein 2 (HLP2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Hepatoma-derived growth factor (HDGF)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein A0 (HNRNPA0)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein F (HNRNPF)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein H (HNRNPH1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein H3 (HNRNPH3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein M (HNRNPM)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Heterogeneous nuclear ribonucleoprotein R (RUVBL1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*hFXR1p (FXR1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*High mobility group protein B1 (HMGB1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Histone acetyltransferase type B catalytic subunit (HAT1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Hsc70-interacting protein (ST13)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Hydroxymethylglutaryl-CoA synthase 1 (HMGCS1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*IGF2-binding protein 2 (IMP-2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*IGF2-binding protein 3 (IMP-3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Inorganic pyrophosphatase (PPA1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Inosine 5'-monophosphate cyclohydrolase (IMP cyclohydrolase)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Interleukin enhancer-binding factor 2 (ILF2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Interleukin enhancer-binding factor 3 (ILF3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*L-xylulose reductase (DCXR)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Large ribosomal subunit protein eL15 (RPL15)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Large subunit GTPase 1 homolog (LSG1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*LINE retrotransposable element 1 (L1ORF1p)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Lupus La protein (SSB)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Matrin-3 (MATR3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Microtubule-associated protein 4 (MAP4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Molybdenum cofactor sulfurase (MOCOS)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Mov34 protein homolog (MOV34L)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Negative regulator of transcription subunit 1 (NOT1H)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Nuclear migration protein nudC (NUDC)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Nuclear receptor coactivator 5 (NCOA5)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Nucleoside diphosphate kinase B (RBM12)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Oxalosuccinate decarboxylase (IDH1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Oxidative stress-associated Src activator (OSSA)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Peroxiredoxin-6 (PRDX6)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Phosphogluconate dehydrogenase (PGD)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Phosphoserine aminotransferase (PSAT1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Placental anticoagulant protein II (PAP-II)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Poly(rC)-binding protein 1*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Poly(rC)-binding protein 2*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Polyadenylate-binding protein 2 (PABPN1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Polyadenylate-binding protein 4 (PABPC4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Polymerase delta-interacting protein 3 (POLDIP3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Polypyrimidine tract-binding protein 3 (PTBP3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Pre-mRNA-processing factor 19 (PRPF19)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proliferation-associated protein 2G4 (PA2G4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome 26S subunit ATPase 1 (P26s4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome 26S subunit ATPase 2 (MSS1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome 26S subunit ATPase 4 (TBP-7)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome activator complex subunit 1 (YBX2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome activator complex subunit 2 (PSME2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome activator complex subunit 3 (PSME3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome assembly chaperone 1 (PSMG1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome beta-1 (PS beta-1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome beta-2 (PS beta-2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome beta-5 (PS beta-5)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome beta-5 (PS beta-5)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit alpha type-1 (PSMA1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit alpha type-2 (PSMA2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit alpha type-3 (PSMA3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit alpha type-4 (PSMA4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit alpha type-6 (PSMA6)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit alpha type-7 (PSMA7)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit beta type-1 (PSMB1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit beta type-2 (PSMB2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit beta type-3 (MAFIP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit p42 (SUG2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit p45 (TRIP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Proteasome subunit p58 (PSMD3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Protein arginine methyltransferase 1 (PRMT1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Protein kinase C inhibitor protein 1 (KCIP-1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Protein lin-28 homolog B (LIN28B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Protein pelota homolog (PELO)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Protein phosphatase 1C catalytic subunit (PPP1CC)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Protein quaking (QKI)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Pseudouridylate synthase 1 homolog (PUS1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Putative trypsin-6 (HNRNPDL)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Pyrroline-5-carboxylate reductase 2 (PYCR2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Rab GDP dissociation inhibitor beta (GDI2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Ran-binding protein 1 (RANBP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Ras-related protein Rab-10 (RAB10)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Ras-related protein Rab-1B (RAB1B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Ras-related protein Rab-2A (RAB2A)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Ras-related protein Rab-7a (RAB7A)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Receptor of activated protein C kinase 1 (RACK1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Ribosome-binding protein 1 (RRBP1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*RNA-binding protein 14 (IGKV1-33)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*RNA-binding protein 4B (RBM4B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*RNA-binding protein FUS (FUS)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*RNA-binding protein Musashi-1 (MSI1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*RNA-binding protein Raly (RALY)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*RNA-splicing ligase RtcB homolog (RTCB)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*rRNA methyltransferase 2 (MRM2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*RuvB-like 1 (EIF5A)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*S-adenosylmethionine synthase type-2 (MAT2A)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*SAP domain-containing ribonucleoprotein (RNPS1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Sec1 family domain-containing protein 1 (SCFD1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Septin-2 (SEPTIN2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Septin-7 (SEPTIN7)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Serine/arginine-rich splicing factor 1 (SRSF1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Serine/arginine-rich splicing factor 10 (SRSF10)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Serine/arginine-rich splicing factor 2 (SRSF2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Serine/arginine-rich splicing factor 3 (SRSF3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Serine/arginine-rich splicing factor 6 (SRSF6)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Serine/arginine-rich splicing factor 7 (SRSF7)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Serine/arginine-rich splicing factor 9 (SRSF9)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Serine/threonine PP1-alpha (PPP1CA)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Small nuclear ribonucleoprotein Sm D2 (SNRPD2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Small nuclear ribonucleoprotein Sm D3 (SNRPD3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Small ribosomal subunit protein eS12 (RPS12)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Sorcin (SRI)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Sorting nexin-5 (SNX5)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*splicing factor (PSF)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Splicing factor U2AF 35 kDa subunit (U2AF1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Suppressor of CDC2 with RNA-binding motif 2 (RBMS1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*SURP and G-patch domain-containing protein 2 (SUGP2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*T-cell-restricted intracellular antigen-1 (TIA-1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*T-complex protein 1 subunit beta (CCT2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*T-complex protein 1 subunit delta (CCT4)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*T-complex protein 1 subunit gamma (CCT3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*TAR DNA binding protein 43 (TARDBP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Tat-binding protein 1 (TBP-1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Tax interaction protein 2 (TIP-2)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Transcriptional activator protein Pur-alpha (PURA)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Transformer-2 protein homolog alpha (TRA2A)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Transformer-2 protein homolog beta (TRA2B)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Transketolase (TK)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Tubulin beta-6 chain (TUBB6)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Tubulin-folding cofactor B (TBCB)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*U1 small nuclear ribonucleoprotein A (SNRPA)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*U1 snRNP 70 kDa (SNRNP70)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Ubiquitin carboxyl-terminal hydrolase 10 (USP10)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Ubiquitin-40S ribosomal protein S27a (RPS27A)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*UDP-glucose 6-dehydrogenase (UGDH)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*UNR-interacting protein (STRAP)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Y-box-binding protein 1 (YBX1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Y-box-binding protein 3 (YBX3)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Zinc finger CCCH-type antiviral protein 1 (ZC3HAV1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Zinc finger CCHC domain-containing protein 3 (PINX1)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)
*Zinc finger protein 638 (ZNF638)*
Protein Details	Pro Info Click to show the detail information of this Protein	[1]
Infection Time	48 h
Infection Cells	Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 )
Cell Originated Tissue	Liver
Interaction Score	FDR ≤ 0.05
Description of Detection Method	comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS)

Virus RNA Sequence Information (Source: GISAID)
>hCoV-19/USA/WA-CDC-02982586-001/2020\|EPI_ISL_404895\|2020-01-19 ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAA AATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGG ACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGC CTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACAT CTTAAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAA ACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAG AACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGA TCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACG GAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTA GCACGTGCTGGTAAAGCTTCATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCG TGAACATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAAT TGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAA CCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCACCAAATGAATG CAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCAGACGGGCGATTTTGTTAAAG CCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAAATGCTGTT GTTAAAATTTATTGTCCAGCATGTCACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGG CTTGAAAACCATTCTTCGTAAGGGTGGTCGCACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACA AGTGTGCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGT CTTAATGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGA GATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGATTATAAAGCAT TCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAGGTGCCTGGAATATTGGTGAA CAGAAATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCGTGTTGTACGATCAATTTTCTCCCGCACTCT TGAAACTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCCGCTATAACAATACTAGATGGAATTTCACAGTATTCACTGA GACTCATTGATGCTATGATGTTCACATCTGATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTT GTTCAGTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGA AGAGAAGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAA TTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGTAAATAAATTT TTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTAGGTGAAACATTTGTCACGCA CTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCCTACTCATGCCTCTAAAAGCCCCAAAAGAAA TTATCTTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTTAACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCA TTAGAACAACCTACTAGTGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGA AATCAAAGACACAGAAAAGTACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTG CACCAACAAAGGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTT GATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAAATGAGTTCGC CTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACCACTGGGCATTGATTTAGATG AGTGGAGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAATTGGCTTCACATATGTATTGTTCTTTCTAC CCTCCAGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAGAAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGA AGATGATTACCAAGGTAAACCTTTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATT GGTTAGATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATT GTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTT AAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAACCAACAGTGGTTGTTA ATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTACTAACAATGCCATGCAAGTT GAATCTGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAA ACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTA ATCAGCACGAAGTTCTACTTGCACCATTATTATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGT GTAGATACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGA AATGAAGAGTGAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTA AACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAA ACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCAGATTCTGCCACTCTTGTTAG TGACATTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTG TGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTAT ATAACCACTTACCCGGGTCAGGGTTTAAATGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGC CTTTTACATTCTACCATCTATTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGC TTGCACATGCAGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAA TATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAACAACTGTAGC GTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTATGTAACACATGGCTTAAATT TGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCG TATAATGGTTATCTTACTTCTTCTTCTAAAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAA AGATTGGTCCTATTCTGGACAATCTACACAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTA GTAATCCTACCACATTCCACCTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTG AGGACTATTAAGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACA ACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGTAAAACATTTT ATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTGATCCTAGTTTTCTGGGTAGG TACATGTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAA CAACTGTTATCTTGCCACTGCATTGTTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTT ATTACAGAGCAAGGGCTGGTGAAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTA GGTGATGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTG TAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAAT TTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTCACCTTTTGTT ATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGTGAGTACACTGGTAATTACCA GTGTGGTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAAT ACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGTTACACAACAACCATAAAACCAGTTACTTATAAATTGGAT GGTGTTGTTTGTACAGAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAAT TGATCTTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTG ATGATTTAAACCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGT GATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAACCTATTGTTTG GCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTGTCTTTGGAGCACAAAACCAG TTGAAACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAA CCAGTCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGT AGGAGACATTATACTTAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTT ATGTAGACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCAT GGTTTAGCTGCTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTAC AACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTATTGCTACAAT TGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAGCAAAGAATACTGTTAAGAGT GTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTATAATTTG GTTTTTACTATTAAGTGTTTGCCTAGGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCA TGCCTTCTTACTGTACTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCT ATACCTTGTAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTC ATCTTTTAAATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCT ATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTCTTGGCTTATG TGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATCTTCTTTGCATCATTTTATTA TGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAA CAAGAGTCGAATGTACAACTATTGTTAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGC AAACTACACAATTGGAATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGA CTTGTCACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATG GTTCCATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC AACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAATGTGAAGAATC ATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACTAGATCAGGCATTAGTGTCTG ATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCA ATGGAAAAACTCAAAACACTAGTTGCAACTGCAGAAGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTAC TTTTATTTCAGCAGCTCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCAC ATCAATCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCC CGTGACCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGAT ATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAGAATAACTTAC CTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAGCACTTAAGGGTGGTAAAATT GTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACC TGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTG ACATAGCATCTACAGATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGTCAGCGTGGTGGTAGTTAT ACTAATGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCAC GATATTACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACAC CATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTTTAAAGATGCT TCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTATGAAAGTTTACGCCCTGACAC ACGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTT TTGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTA CTTAACAATGATTATTACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTAC ACCACTAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACAT GCCTTGCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTC CTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTTACTTGTACTT GACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTTCACACCTTTAGTACCTTTCT GGATAACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTA GTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAA GTTGCGTAGTGATGTGCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTG GAGCAATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGT TCTGATGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCC ATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTTGATGACGTAG TTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAGATTTACTCATTCGTAAGTCT AATCATAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCT TAAGGTTGATACAGCCAATCCTAAGACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAG CTTGTTACAATGGTTCACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAAT GGTTCATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAAC TGGAGTTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTA CGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTTTCTCAATCGA TTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTAACACAAGACCATGTTGACAT ACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAATGGTA TGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGT GTTACTTTCCAAAGTGCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTT AGTTTTAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTA TTGCTATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCC ACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATATGGTTGATAC TAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACTAATCCTTATGACAGCAAGAA CTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAAT GCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCAT GTTTTTGGCCAGAGGTATTGTTTTTATGTGTGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTA TAATGCTAGTTTATTGTTTCTTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGA CTGACTCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAA GAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTAGCCACTGTAC AGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCATCT AAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAAAGATACTACTGAAGCCTTTGAAAAAATGGT TTCACTACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTAGACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGG CAACCTTACAAGCTATAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAG CAGGCTGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGA CCGTGATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTG AGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAATGATGCACTC AACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACAACAGCAGCCAAACTAATGGT TGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACATTTACTTATGCATCAGCATTGTGGGAAATCC AACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAGTGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCT CTTATTGTAACAGCTTTAAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGAT GTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTA GGTTTGTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATC TATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTATACTTTATTAA AGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCTACAAGCTGGTAATGCAACAG AAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCT AGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACC GGAAGCCAATATGGATCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATC CTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTT AAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCA GTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAG TACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTT GTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTAC CAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGA CGGTGACATGGTACCACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATT TTGATGAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAG GACTGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTT AAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAAGATCTCAATG GTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTG TTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAA GTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACAT ACCACCCAAATTGTGTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTG TTCCCACCTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCA CTTCAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGT ATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTCAGTAGCTGCA CTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGG TTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATG ACTACTATCGTTATAATCTACCAACAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTT GATTGTTACGATGGTGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAA TAAATGGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTA ATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC TCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAGGAGCTACTGT AGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTAGAAAACCCTCACC TTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGC AAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGT CATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTT TTAACATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTC CGCAATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGC ATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTATGCATCTCAAG GTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGG ACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGT GTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACAC TTATGATTGAACGGTTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTC TTTCATTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCT TACTAATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTG TTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTTATGTTGTAAA TGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTATGTTTGCAATGCTCCAGGTTG TGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATTGTAAATCACATAAACCACCCATTAGTTTTC CATTGTGTGCTAATGGACAAGTTTTTGGTTTATATAAAAATACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCA ATTGCAACATGTGACTGGACAAATGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGC AGAAACGCTCAAAGCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAG AATTACATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACT AAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACCGAGGTACAAC AACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATTAAGTGCACCTACACTAGTGC CACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATCTCAGATGAGTTTTCTAGCAATGTTGCAAAT TATCAAAAGGTTGGTATGCAAAAGTATTCTACACTCCAGGGACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCT AGCTCTCTACTACCCTTCTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCAT TAAAATATTTGCCTATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTG AATTCAACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGA AATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTACATTGGCGACC CTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTT ATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTT GGTTTATGATAATAAGCTTAAAGCACATAAAGACAAATCAGCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGC ATGATGTTTCATCTGCAATTAACAGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAA GCTGTCTTTATTTCACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTC ATCACAGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTA ATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTTGCAATTTACA AGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTTTTTAAAGATTGTAGTAAGGT AATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTG ACATACCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAAT GGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTG TCATGCTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTAC CTACAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAA CACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAAGTGACACACT TAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATCTATGAAGTATTTTGTGAAAA TAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGG CATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACA AAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAG CTGTCCACGAGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCG GCTTGTAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAA CCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGTGACAAAGCTT ATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTGTATGCCTATTTTGGAATTGC AATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTG TGATGGTGGCAGTTTGTATGTAAATAAACATGCATTCCACACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAAC AATTACCATTTTTCTATTACTCTGACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCA CTAAAGTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTA TCTCGATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGA ACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGGACAACAGGGT GAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTAGAATTGTTTGAAAATAAAAC AACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTAAACCAGTACCAGAGGTGAAAATACTCAATA ATTTGGGTGTGGACATTGCTGCTAATACTGTGATCTGGGACTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGT GTTTGTTCTATGACTGACATAGCCAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGT TGATGGTCAAGTAGACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCAT CTGTAGGTCCCAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAG AAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTAAACCCAGGAG TCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATTAGAAGGCTATGCCTTCGAAC ATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAA TCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTACAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTC ATCTAAGTGTGTGTGTTCTGTTATTGATTTATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAG TTTCTAAGGTTGTCAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACA TTTTACCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCT ATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTCGCAAAATATA CTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTATACATTTTGGTGCTGGTTCT GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTACGGGTACGCTGCTTGTCGATTCAGATCTTAA TGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGATTGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTA TTAGTGATATGTACGACCCTAAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGT GGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTA TAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTG GATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACA AATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTC TTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAG TTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAG TCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTG ACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCAT GCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGC TTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTG TTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCAC AAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCA GCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTT ATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTG GTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGA TTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATA ATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTC ACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTAC AAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCA ACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAA TTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGG GCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACA ATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGA GATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACA ATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATG CACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTA ACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTAC TGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACAC CAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCA GATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGC TGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATT CTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCT TACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAA GACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTT GTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAA CAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAG CAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATT GCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACA GATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGC ATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACC AAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGA AAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAAT TTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCA GACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCT ACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCC TCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTG CCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAA AGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGT CAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATA CATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTC AATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCC ATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTT GCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAA GGAGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGAATCTTCACAATTGGAACTGTAACTTTGAAG CAAGGTGAAATCAAGGATGCTACTCCTTCAGATTTTGTTCGCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTT CGGATGGCTTATTGTTGGCGTTGCACTTCTTGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGC AACTAGCACTCTCCAAGGGTGTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTC GTTGCTGCTGGCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAAT AATAATGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTTCTTTGCTGGC ATACTAATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTACTTCAGGTGATGGCACAACA AGTCCTATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATGGGAATCTGGAGTAAAAGACTGTGTTGTATT ACACAGTTACTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCT TCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTT AATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGA ACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTAT TCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTA AAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAAACGAACTA AATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCT TAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATG CCAACAGGAATAGGTTTTTGTATATAATTAAGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTG CTTGCTGCTGTTTACAGAATAAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCT CAGCTACTTCATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTC TCAACGTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGTGATCCTTCGT GGACATCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAAGAAATCACTGTTGCTACATC ACGAACGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTGACTCAGGTTTTGCTGCATACAGTCGCTACA GGATTGGCAACTATAAATTAAACACAGACCATTCCAGTAGCAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACA GATGTTTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTT GGAATCTTGATTACATCATAAACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGAT GAAGAGCAACCAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGA GCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACATACGAGGGCA ATTCACCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAATTTGCTTTTGCTTGTCCTGAC GGCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACTGTTCATCAGACAAGAGGAAGTTCAAGAACT TTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTTATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGAT TGAACTTTCATTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTT GGTTCTCACTTGAACTGCAAGATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATC ATCACAACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCC GTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAATTGTGCGTGG ATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCTGTTCACCTTTTACAATTAAT TGCCAGGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGAAGACTTTTTAGAGTATCATGACGTTCGTGT TGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTAC GTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCC AAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGA CAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGG TGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCT ATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGC AATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAG CAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTA GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAG CTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAA GAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC AAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCC AGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGC CATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACAT TCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAG CAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTC AACTCAGGCCTAAACTCATGCAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATA GTCTACTCTTGTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCT TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGT ACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCAT GTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAA Click to Show/Hide

References
1	Discovery and functional interrogation of SARS-CoV-2 RNA-host protein interactions. Cell. 2021 Apr 29;184(9):2394-2411.e16.

Details of Virus RNA

Cite CovInter

About CovInter

Correspondence