Details of Virus RNA
| Virus RNA General Information | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Information | Strain Name |
hCoV-19/USA/WA1/2020
|
|||||||
| Strain Family |
Alpha (B.1.1.7)
|
||||||||
| GISAID Accession |
EPI_ISL_404895
Info
Collection Date: 2020/1/19
Originating Lab: Providence Regional Medical Center
Submitting Lab: Division of Viral Diseases, Centers for Disease Control and Prevention
Authors: Queen, K., Tao, Y., Li, Y., Paden, C.R., Lu, X., Zhang, J., Gerber, S.I., Lindstrom, S., Tong, S.
|
EPI_SET ID | EPI_SET_220823ya | ||||||
| Strain Mutation Site |
T1001I; A1708D; I2230T; N501Y; A570D; P681H; T716I; S982A; D1118H; Q27*; R52I; Y73C; D3L; S235F
|
||||||||
| RNA Binding Site |
Not Specified Virus Region
|
||||||||
| Virus Information | Virus Name |
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
|
|||||||
| Taxonomy ID | 2697049 | ||||||||
| Virus RNA - Host Protein Network | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Regulation Network | |||||||||
| Full list of proteins interacting with the Not Specified Virus Region of this Strain | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| hnRNP A1 messenger RNA (HNRNPA1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| IGF2-binding protein 1 (IMP-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Elongation factor 1-alpha 1 (EEF1A1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Eukaryotic initiation factor 4A-I (EIF4A1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| APOBEC1-binding protein 1 (HNRNPAB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Polyadenylate-binding protein 1 (PABPC1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Polypyrimidine tract-binding protein (PTBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| hnRNP A2/B1 messenger RNA (HNRNPA2B1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Spliceosome RNA helicase DDX39B (EXOSC6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein L (LGALS4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein K (HNRNPK) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein Q (SYNCRIP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein U (HNRNPU) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| ELAV-like protein 1 (ELAVL1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Nucleolin (NCL) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 14-3-3 protein theta (HS1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 18 kDa phosphoprotein (p18) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 26S proteasome regulatory subunit RPN1 (TRAP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 26S proteasome regulatory subunit RPN11 (POH1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 26S proteasome regulatory subunit RPN5 (PSMD12) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 26S proteasome regulatory subunit RPN9 (PSMD13) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 26S proteasome regulatory subunit S10 (p42A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 26S proteasome subunit S5B (KIAA0072) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 40S ribosomal protein S15 (RPS14) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 40S ribosomal protein S18 (H4C1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 40S ribosomal protein S20 (RPS2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 40S ribosomal protein S27-like (RPS26) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 40S ribosomal protein S3a (RPS3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 40S ribosomal protein S4, X isoform (RPS3A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 40S ribosomal protein S5 (RPS4X) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 60S ribosomal protein L13a (RPL13) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 60S ribosomal protein L26 (RPL24) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| 60S ribosomal protein L9 (RPL8) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Acetyl-CoA transferase-like protein (ACTL) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Adenosylhomocysteinase (AHCY) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Adenylosuccinate lyase (ADSL) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| ADP-ribosylation factor 4 (ARF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Alcohol dehydrogenase 5 (FALDH) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Aldehyde dehydrogenase 1A1 (ALHDII) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| ALG-2-interacting protein 1 (PDCD6IP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Alpha-actinin-4 (ACTN4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Annexin A5 (ANXA5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Antisecretory factor 1 (ASF) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| AP endonuclease 1 (APEX1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| AP-3 adaptor complex mu3A subunit (AP3M1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| APC-binding protein EB1 (EB1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| ASF/SF2-associated protein p32 (C1QBP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| ATP-citrate synthase (ACLY) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| ATP-dependent RNA helicase A (DHX9) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| ATP-dependent RNA helicase DDX5 (DDX5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| AU-rich element RNA-binding protein 1 (AUF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Calponin-3 (CNN3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Cellular nucleic acid-binding protein (CNBP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Clathrin heavy chain on chromosome 17 (CLH-17) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Cleavage factor Im complex 59 kDa subunit (CFIm59) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Cleavage stimulation factor 64 kDa subunit (CstF-64) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Cleavage stimulation factor subunit 3 (CstF-77) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Coatomer subunit beta (p102) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Cold shock domain-containing protein E1 (CSDE1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Coronin-1B (CORO1B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Creatine kinase B-type (CKB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Cullin-associated NEDD8-dissociated protein 1 (CAND1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Cytosolic non-specific dipeptidase (CNDP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Cytovillin (EZR) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| D-fructose-6-phosphate amidotransferase 1 (GFPT1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| DAZ-associated protein 1 (DAZAP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| DBIRD complex subunit ZNF326 (ZNF326) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| DEAD box protein 17 (DDX17) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| DEAD box protein 19A (DDX19L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| DEAD box protein 39 (DDX39) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| DEAD box protein 6 (DDX6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Deleted in breast cancer gene 1 protein (DBC-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| DRG family-regulatory protein 1 (ZC3H15) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| E1B-55 kDa-associated protein 5 (E1B-AP5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| EBNA2 coactivator p100 (SND1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| eIF-2-alpha (EIF2S1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| eIF-2-gamma X (EIF2S3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| eIF-3-eta (EIF3B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| eIF5-mimic protein 2 (BZW1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Ester hydrolase C11orf54 (C11orf54) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Eukaryotic initiation factor 4A-III (EIF4A3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Eukaryotic release factor 1 (ETF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Eukaryotic translation initiation factor 3 subunit F (EIF3F) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Eukaryotic translation initiation factor 3 subunit I (EIF3I) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Eukaryotic translation initiation factor 4B (EIF4B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Eukaryotic translation initiation factor 4H (EIF4H) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Extracellular signal-regulated kinase 2 (ERK2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Ezrin-radixin-moesin-binding phosphoprotein 50 (EBP50) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| F-actin-capping protein subunit alpha-1 (CAPZA1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| F-actin-capping protein subunit beta (CAPZB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Far upstream element-binding protein 1 (FUBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Far upstream element-binding protein 2 (KHSRP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Far upstream element-binding protein 3 (FUBP3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Fatty acid synthase (FASN) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Fatty acid-binding protein 1 (FABP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Flap endonuclease 1 (FEN1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| GAP SH3 domain-binding protein 1 (G3BP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| GAP SH3 domain-binding protein 2 (G3BP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| GAP-associated tyrosine phosphoprotein p62 (KHDRBS1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| General vesicular transport factor p115 (USO1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Glucose-6-phosphate isomerase (GPI) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Glutathione reductase (GR) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Glutathione S-transferase P (GSTP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Glycoprotein p43 (RBMX) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| GTP-binding nuclear protein Ran (RAN) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heat shock 70 kDa protein 4 (HSPA4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heat shock protein 20 (HSP20) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heat shock protein 40 (HSP40) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Helicase MOV-10 (MOV10) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Helicase-like protein 2 (HLP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Hepatoma-derived growth factor (HDGF) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein A0 (HNRNPA0) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein F (HNRNPF) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein H (HNRNPH1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein H3 (HNRNPH3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein M (HNRNPM) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein R (RUVBL1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| hFXR1p (FXR1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| High mobility group protein B1 (HMGB1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Histone acetyltransferase type B catalytic subunit (HAT1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Hsc70-interacting protein (ST13) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Hydroxymethylglutaryl-CoA synthase 1 (HMGCS1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| IGF2-binding protein 2 (IMP-2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| IGF2-binding protein 3 (IMP-3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Inorganic pyrophosphatase (PPA1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Inosine 5'-monophosphate cyclohydrolase (IMP cyclohydrolase) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Interleukin enhancer-binding factor 2 (ILF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Interleukin enhancer-binding factor 3 (ILF3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| L-xylulose reductase (DCXR) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Large ribosomal subunit protein eL15 (RPL15) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Large subunit GTPase 1 homolog (LSG1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| LINE retrotransposable element 1 (L1ORF1p) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Lupus La protein (SSB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Matrin-3 (MATR3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Microtubule-associated protein 4 (MAP4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Molybdenum cofactor sulfurase (MOCOS) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Mov34 protein homolog (MOV34L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Negative regulator of transcription subunit 1 (NOT1H) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Nuclear migration protein nudC (NUDC) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Nuclear receptor coactivator 5 (NCOA5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Nucleoside diphosphate kinase B (RBM12) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Oxalosuccinate decarboxylase (IDH1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Oxidative stress-associated Src activator (OSSA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Peroxiredoxin-6 (PRDX6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Phosphogluconate dehydrogenase (PGD) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Phosphoserine aminotransferase (PSAT1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Placental anticoagulant protein II (PAP-II) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Poly(rC)-binding protein 1 | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Poly(rC)-binding protein 2 | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Polyadenylate-binding protein 2 (PABPN1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Polyadenylate-binding protein 4 (PABPC4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Polymerase delta-interacting protein 3 (POLDIP3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Polypyrimidine tract-binding protein 3 (PTBP3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Pre-mRNA-processing factor 19 (PRPF19) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proliferation-associated protein 2G4 (PA2G4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome 26S subunit ATPase 1 (P26s4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome 26S subunit ATPase 2 (MSS1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome 26S subunit ATPase 4 (TBP-7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome activator complex subunit 1 (YBX2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome activator complex subunit 2 (PSME2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome activator complex subunit 3 (PSME3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome assembly chaperone 1 (PSMG1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome beta-1 (PS beta-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome beta-2 (PS beta-2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome beta-5 (PS beta-5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome beta-5 (PS beta-5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit alpha type-1 (PSMA1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit alpha type-2 (PSMA2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit alpha type-3 (PSMA3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit alpha type-4 (PSMA4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit alpha type-6 (PSMA6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit alpha type-7 (PSMA7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit beta type-1 (PSMB1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit beta type-2 (PSMB2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit beta type-3 (MAFIP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit p42 (SUG2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit p45 (TRIP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Proteasome subunit p58 (PSMD3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Protein arginine methyltransferase 1 (PRMT1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Protein kinase C inhibitor protein 1 (KCIP-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Protein lin-28 homolog B (LIN28B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Protein pelota homolog (PELO) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Protein phosphatase 1C catalytic subunit (PPP1CC) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Protein quaking (QKI) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Pseudouridylate synthase 1 homolog (PUS1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Putative trypsin-6 (HNRNPDL) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Pyrroline-5-carboxylate reductase 2 (PYCR2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Rab GDP dissociation inhibitor beta (GDI2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Ran-binding protein 1 (RANBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Ras-related protein Rab-10 (RAB10) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Ras-related protein Rab-1B (RAB1B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Ras-related protein Rab-2A (RAB2A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Ras-related protein Rab-7a (RAB7A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Receptor of activated protein C kinase 1 (RACK1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Ribosome-binding protein 1 (RRBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| RNA-binding protein 14 (IGKV1-33) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| RNA-binding protein 4B (RBM4B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| RNA-binding protein FUS (FUS) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| RNA-binding protein Musashi-1 (MSI1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| RNA-binding protein Raly (RALY) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| RNA-splicing ligase RtcB homolog (RTCB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| rRNA methyltransferase 2 (MRM2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| RuvB-like 1 (EIF5A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| S-adenosylmethionine synthase type-2 (MAT2A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| SAP domain-containing ribonucleoprotein (RNPS1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Sec1 family domain-containing protein 1 (SCFD1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Septin-2 (SEPTIN2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Septin-7 (SEPTIN7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Serine/arginine-rich splicing factor 1 (SRSF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Serine/arginine-rich splicing factor 10 (SRSF10) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Serine/arginine-rich splicing factor 2 (SRSF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Serine/arginine-rich splicing factor 3 (SRSF3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Serine/arginine-rich splicing factor 6 (SRSF6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Serine/arginine-rich splicing factor 7 (SRSF7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Serine/arginine-rich splicing factor 9 (SRSF9) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Serine/threonine PP1-alpha (PPP1CA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Small nuclear ribonucleoprotein Sm D2 (SNRPD2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Small nuclear ribonucleoprotein Sm D3 (SNRPD3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Small ribosomal subunit protein eS12 (RPS12) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Sorcin (SRI) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Sorting nexin-5 (SNX5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| splicing factor (PSF) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Splicing factor U2AF 35 kDa subunit (U2AF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Suppressor of CDC2 with RNA-binding motif 2 (RBMS1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| SURP and G-patch domain-containing protein 2 (SUGP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| T-cell-restricted intracellular antigen-1 (TIA-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| T-complex protein 1 subunit beta (CCT2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| T-complex protein 1 subunit delta (CCT4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| T-complex protein 1 subunit gamma (CCT3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| TAR DNA binding protein 43 (TARDBP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Tat-binding protein 1 (TBP-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Tax interaction protein 2 (TIP-2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Transcriptional activator protein Pur-alpha (PURA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Transformer-2 protein homolog alpha (TRA2A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Transformer-2 protein homolog beta (TRA2B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Transketolase (TK) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Tubulin beta-6 chain (TUBB6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Tubulin-folding cofactor B (TBCB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| U1 small nuclear ribonucleoprotein A (SNRPA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| U1 snRNP 70 kDa (SNRNP70) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Ubiquitin carboxyl-terminal hydrolase 10 (USP10) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Ubiquitin-40S ribosomal protein S27a (RPS27A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| UDP-glucose 6-dehydrogenase (UGDH) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| UNR-interacting protein (STRAP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Y-box-binding protein 1 (YBX1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Y-box-binding protein 3 (YBX3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Zinc finger CCCH-type antiviral protein 1 (ZC3HAV1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Zinc finger CCHC domain-containing protein 3 (PINX1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Zinc finger protein 638 (ZNF638) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 48 h | ||||||||
| Infection Cells | Huh7.5 cells (Hepatocyte derived cellular carcinoma cell) (CVCL_7927 ) | ||||||||
| Cell Originated Tissue | Liver | ||||||||
| Interaction Score | FDR ≤ 0.05 | ||||||||
| Description of Detection Method | comprehensive identification of RNA-binding proteins by massspectrometry (ChIRP-MS) | ||||||||
| Virus RNA Sequence Information (Source: GISAID) |
>hCoV-19/USA/WA-CDC-02982586-001/2020|EPI_ISL_404895|2020-01-19
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAA
AATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGG
ACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT
CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGC
CTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACAT
CTTAAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAA
ACGTTCGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC
GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAG
AACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGA
TCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACG
GAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTA
GCACGTGCTGGTAAAGCTTCATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCG
TGAACATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAAT
TGGCAAAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAA
CCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCACCAAATGAATG
CAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCAGACGGGCGATTTTGTTAAAG
CCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAAATGCTGTT
GTTAAAATTTATTGTCCAGCATGTCACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGG
CTTGAAAACCATTCTTCGTAAGGGTGGTCGCACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACA
AGTGTGCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGT
CTTAATGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGA
GATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGATTATAAAGCAT
TCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAGGTGCCTGGAATATTGGTGAA
CAGAAATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCGTGTTGTACGATCAATTTTCTCCCGCACTCT
TGAAACTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCCGCTATAACAATACTAGATGGAATTTCACAGTATTCACTGA
GACTCATTGATGCTATGATGTTCACATCTGATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTT
GTTCAGTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGA
AGAGAAGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAA
TTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGTAAATAAATTT
TTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTAGGTGAAACATTTGTCACGCA
CTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCCTACTCATGCCTCTAAAAGCCCCAAAAGAAA
TTATCTTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTTAACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCA
TTAGAACAACCTACTAGTGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGA
AATCAAAGACACAGAAAAGTACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTG
CACCAACAAAGGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTT
GATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAAATGAGTTCGC
CTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACCACTGGGCATTGATTTAGATG
AGTGGAGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAATTGGCTTCACATATGTATTGTTCTTTCTAC
CCTCCAGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAGAAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGA
AGATGATTACCAAGGTAAACCTTTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATT
GGTTAGATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATT
GTTGAGGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTT
AAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAACCAACAGTGGTTGTTA
ATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTACTAACAATGCCATGCAAGTT
GAATCTGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAA
ACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTA
ATCAGCACGAAGTTCTACTTGCACCATTATTATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGT
GTAGATACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGA
AATGAAGAGTGAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTA
AACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAA
ACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCAGATTCTGCCACTCTTGTTAG
TGACATTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTG
TGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTAT
ATAACCACTTACCCGGGTCAGGGTTTAAATGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGC
CTTTTACATTCTACCATCTATTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGC
TTGCACATGCAGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAA
TATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAACAACTGTAGC
GTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTATGTAACACATGGCTTAAATT
TGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCG
TATAATGGTTATCTTACTTCTTCTTCTAAAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAA
AGATTGGTCCTATTCTGGACAATCTACACAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTA
GTAATCCTACCACATTCCACCTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTG
AGGACTATTAAGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACA
ACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGTAAAACATTTT
ATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTGATCCTAGTTTTCTGGGTAGG
TACATGTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAA
CAACTGTTATCTTGCCACTGCATTGTTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTT
ATTACAGAGCAAGGGCTGGTGAAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTA
GGTGATGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTG
TAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAAT
TTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTCACCTTTTGTT
ATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGTGAGTACACTGGTAATTACCA
GTGTGGTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAAT
ACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAGTTACACAACAACCATAAAACCAGTTACTTATAAATTGGAT
GGTGTTGTTTGTACAGAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAAT
TGATCTTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTG
ATGATTTAAACCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGT
GATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAACCTATTGTTTG
GCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTGTCTTTGGAGCACAAAACCAG
TTGAAACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAA
CCAGTCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGT
AGGAGACATTATACTTAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTT
ATGTAGACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCAT
GGTTTAGCTGCTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTAC
AACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTATTGCTACAAT
TGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAGCAAAGAATACTGTTAAGAGT
GTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTATAATTTG
GTTTTTACTATTAAGTGTTTGCCTAGGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCA
TGCCTTCTTACTGTACTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCT
ATACCTTGTAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTC
ATCTTTTAAATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCT
ATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTCTTGGCTTATG
TGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATCTTCTTTGCATCATTTTATTA
TGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAA
CAAGAGTCGAATGTACAACTATTGTTAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGC
AAACTACACAATTGGAATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGA
CTTGTCACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATG
GTTCCATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC
AACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAATGTGAAGAATC
ATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACTAGATCAGGCATTAGTGTCTG
ATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCA
ATGGAAAAACTCAAAACACTAGTTGCAACTGCAGAAGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTAC
TTTTATTTCAGCAGCTCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCAC
ATCAATCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCC
CGTGACCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGAT
ATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAGAATAACTTAC
CTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAGCACTTAAGGGTGGTAAAATT
GTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACC
TGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTG
ACATAGCATCTACAGATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGTCAGCGTGGTGGTAGTTAT
ACTAATGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCAC
GATATTACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACAC
CATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTTTAAAGATGCT
TCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTATGAAAGTTTACGCCCTGACAC
ACGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTT
TTGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTA
CTTAACAATGATTATTACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTAC
ACCACTAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACAT
GCCTTGCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTC
CTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTTACTTGTACTT
GACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTTCACACCTTTAGTACCTTTCT
GGATAACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTA
GTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAA
GTTGCGTAGTGATGTGCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTG
GAGCAATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGT
TCTGATGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCC
ATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTTGATGACGTAG
TTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAGATTTACTCATTCGTAAGTCT
AATCATAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCT
TAAGGTTGATACAGCCAATCCTAAGACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAG
CTTGTTACAATGGTTCACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAAT
GGTTCATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAAC
TGGAGTTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTA
CGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTTTCTCAATCGA
TTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTAACACAAGACCATGTTGACAT
ACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAATGGTA
TGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGT
GTTACTTTCCAAAGTGCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTT
AGTTTTAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTA
TTGCTATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCC
ACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATATGGTTGATAC
TAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACTAATCCTTATGACAGCAAGAA
CTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAAT
GCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCAT
GTTTTTGGCCAGAGGTATTGTTTTTATGTGTGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTA
TAATGCTAGTTTATTGTTTCTTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGA
CTGACTCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAA
GAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTAGCCACTGTAC
AGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCATCT
AAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAAAGATACTACTGAAGCCTTTGAAAAAATGGT
TTCACTACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTAGACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGG
CAACCTTACAAGCTATAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAG
CAGGCTGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGA
CCGTGATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTG
AGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAATGATGCACTC
AACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACAACAGCAGCCAAACTAATGGT
TGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACATTTACTTATGCATCAGCATTGTGGGAAATCC
AACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAGTGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCT
CTTATTGTAACAGCTTTAAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGAT
GTCTTGTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTA
GGTTTGTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATC
TATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTATACTTTATTAA
AGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCTACAAGCTGGTAATGCAACAG
AAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCT
AGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACC
GGAAGCCAATATGGATCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATC
CTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTT
AAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCA
GTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAG
TACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTT
GTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTAC
CAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGA
CGGTGACATGGTACCACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATT
TTGATGAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAG
GACTGGTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTT
AAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAAGATCTCAATG
GTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTG
TTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAA
GTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACAT
ACCACCCAAATTGTGTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTG
TTCCCACCTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCA
CTTCAGAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGT
ATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTCAGTAGCTGCA
CTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGG
TTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATG
ACTACTATCGTTATAATCTACCAACAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTT
GATTGTTACGATGGTGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAA
TAAATGGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTA
ATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC
TCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAGGAGCTACTGT
AGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTAGAAAACCCTCACC
TTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGC
AAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGT
CATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTT
TTAACATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTC
CGCAATTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGC
ATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTATGCATCTCAAG
GTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGG
ACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGT
GTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACAC
TTATGATTGAACGGTTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTC
TTTCATTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCT
TACTAATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTG
TTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTTATGTTGTAAA
TGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTATGTTTGCAATGCTCCAGGTTG
TGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATTGTAAATCACATAAACCACCCATTAGTTTTC
CATTGTGTGCTAATGGACAAGTTTTTGGTTTATATAAAAATACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCA
ATTGCAACATGTGACTGGACAAATGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGC
AGAAACGCTCAAAGCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAG
AATTACATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACT
AAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACCGAGGTACAAC
AACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATTAAGTGCACCTACACTAGTGC
CACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATCTCAGATGAGTTTTCTAGCAATGTTGCAAAT
TATCAAAAGGTTGGTATGCAAAAGTATTCTACACTCCAGGGACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCT
AGCTCTCTACTACCCTTCTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCAT
TAAAATATTTGCCTATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTG
AATTCAACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGA
AATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTACATTGGCGACC
CTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTT
ATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTT
GGTTTATGATAATAAGCTTAAAGCACATAAAGACAAATCAGCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGC
ATGATGTTTCATCTGCAATTAACAGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAA
GCTGTCTTTATTTCACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTC
ATCACAGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTA
ATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTTGCAATTTACA
AGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTTTTTAAAGATTGTAGTAAGGT
AATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTG
ACATACCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAAT
GGTTACCCTAACATGTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTG
TCATGCTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTAC
CTACAGGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAA
CACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAAGTGACACACT
TAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATCTATGAAGTATTTTGTGAAAA
TAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGG
CATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACA
AAGCAACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAG
CTGTCCACGAGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCG
GCTTGTAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAA
CCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGTGACAAAGCTT
ATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTGTATGCCTATTTTGGAATTGC
AATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTG
TGATGGTGGCAGTTTGTATGTAAATAAACATGCATTCCACACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAAC
AATTACCATTTTTCTATTACTCTGACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCA
CTAAAGTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTA
TCTCGATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGA
ACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGGACAACAGGGT
GAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTAGAATTGTTTGAAAATAAAAC
AACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTAAACCAGTACCAGAGGTGAAAATACTCAATA
ATTTGGGTGTGGACATTGCTGCTAATACTGTGATCTGGGACTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGT
GTTTGTTCTATGACTGACATAGCCAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGT
TGATGGTCAAGTAGACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCAT
CTGTAGGTCCCAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAG
AAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTAAACCCAGGAG
TCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATTAGAAGGCTATGCCTTCGAAC
ATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAA
TCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTACAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTC
ATCTAAGTGTGTGTGTTCTGTTATTGATTTATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAG
TTTCTAAGGTTGTCAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACA
TTTTACCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCT
ATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTCGCAAAATATA
CTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTATACATTTTGGTGCTGGTTCT
GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTACGGGTACGCTGCTTGTCGATTCAGATCTTAA
TGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGATTGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTA
TTAGTGATATGTACGACCCTAAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGT
GGGTTTATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTA
TAAGCTCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTG
GATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACA
AATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTC
TTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAG
TTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAG
TCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTG
ACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCAT
GCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGC
TTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTG
TTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCAC
AAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCA
GCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTT
ATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTG
GTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGA
TTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATA
ATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTC
ACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTAC
AAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCA
ACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAA
TTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGG
GCAAACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACA
ATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGA
GATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACA
ATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATG
CACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTA
ACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTAC
TGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACAC
CAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCA
GATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGC
TGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATT
CTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCT
TACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAA
GACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTT
GTACACAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAA
CAAATTTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAG
CAAGAGGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATT
GCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACA
GATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGC
ATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACC
AAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGA
AAACTTCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAAT
TTCAAGTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCA
GACTTCAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCT
ACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCC
TCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTG
CCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAA
AGGAATTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGT
CAACAACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATA
CATCACCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTC
AATGAGGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCC
ATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTT
GCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAA
GGAGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGAATCTTCACAATTGGAACTGTAACTTTGAAG
CAAGGTGAAATCAAGGATGCTACTCCTTCAGATTTTGTTCGCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTT
CGGATGGCTTATTGTTGGCGTTGCACTTCTTGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGC
AACTAGCACTCTCCAAGGGTGTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTC
GTTGCTGCTGGCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAAT
AATAATGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTTCTTTGCTGGC
ATACTAATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTACTTCAGGTGATGGCACAACA
AGTCCTATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATGGGAATCTGGAGTAAAAGACTGTGTTGTATT
ACACAGTTACTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCT
TCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTT
AATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGA
ACTTATGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTAT
TCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTA
AAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAAACGAACTA
AATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCT
TAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATG
CCAACAGGAATAGGTTTTTGTATATAATTAAGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTG
CTTGCTGCTGTTTACAGAATAAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCT
CAGCTACTTCATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTC
TCAACGTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGTGATCCTTCGT
GGACATCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAAGAAATCACTGTTGCTACATC
ACGAACGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTGACTCAGGTTTTGCTGCATACAGTCGCTACA
GGATTGGCAACTATAAATTAAACACAGACCATTCCAGTAGCAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACA
GATGTTTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTT
GGAATCTTGATTACATCATAAACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGAT
GAAGAGCAACCAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGA
GCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACATACGAGGGCA
ATTCACCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAATTTGCTTTTGCTTGTCCTGAC
GGCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACTGTTCATCAGACAAGAGGAAGTTCAAGAACT
TTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTTATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGAT
TGAACTTTCATTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTT
GGTTCTCACTTGAACTGCAAGATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATC
ATCACAACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCC
GTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAATTGTGCGTGG
ATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCTGTTCACCTTTTACAATTAAT
TGCCAGGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGAAGACTTTTTAGAGTATCATGACGTTCGTGT
TGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTAC
GTTTGGTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCC
AAGGTTTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGA
CAAGGCGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGG
TGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCT
ATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGC
AATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAG
CAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTA
GGGGAACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAG
CTTGAGAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAA
GAAGCCTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC
AAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCC
AGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGC
CATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACAT
TCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAG
CAAACTGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTC
AACTCAGGCCTAAACTCATGCAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATA
GTCTACTCTTGTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCT
TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGT
ACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCAT
GTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAA
Click to Show/Hide
|
|---|
| References | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | Discovery and functional interrogation of SARS-CoV-2 RNA-host protein interactions. Cell. 2021 Apr 29;184(9):2394-2411.e16. | ||||||||||||||||||

