Virus RNA General Information
Strain Information		Strain Name		hCoV-19/England/02/2020
		Strain Family		Beta (B.1.351)
		GISAID Accession		EPI_ISL_407073    Info  Collection Date: 2020/1/29 Originating Lab: Respiratory Virus Unit, Microbiology Services Colindale, Public Health England Submitting Lab: Respiratory Virus Unit, Microbiology Services Colindale, Public Health England Authors: Monica Galiano, Shahjahan Miah, Richard Myers, Angie Lackenby, Omolola Akinbami, Tiina Talts, Leena Bhaw, Kirstin Edwards, Jonathan Hubb, Joanna Ellis, Maria Zambon.		EPI_SET ID		EPI_SET_220823ya
		RNA Binding Site		Not Specified Virus Region
Virus Information		Virus Name		Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
		Taxonomy ID		2697049

Virus RNA - Host Protein Network
Regulation Network
		Network Download

Full list of proteins interacting with the Not Specified Virus Region of this Strain
hnRNP A1 messenger RNA (HNRNPA1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.030
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
IGF2-binding protein 1 (IMP-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.033
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
APOBEC1-binding protein 1 (HNRNPAB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.056
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
hnRNP A2/B1 messenger RNA (HNRNPA2B1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.093
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Spliceosome RNA helicase DDX39B (EXOSC6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.010
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Lipopolysaccharide-associated protein 1 (HSPA8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heterogeneous nuclear ribonucleoprotein L (LGALS4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.059
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heterogeneous nuclear ribonucleoprotein K (HNRNPK)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.095
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heterogeneous nuclear ribonucleoprotein Q (SYNCRIP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.037
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.007
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S7 (RPS6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
NonO protein (NONO)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.064
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
14-3-3 protein zeta/delta (KCIP-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.096
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
28S ribosomal protein S23 (MRP-S23)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.033
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
28S ribosomal protein S31 (Imogen 38)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.046
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
28S ribosomal protein S5 (S5mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.030
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
28S ribosomal protein S7 (MRP-S7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.059
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
39S ribosomal protein L13 (MRP-L13)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.029
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
39S ribosomal protein L3 (MRP-L3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.020
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
39S ribosomal protein L37 (L2mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.076
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S11 (RPS10)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.004
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S14 (RPS11)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.009
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S15 (RPS14)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.004
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S15a (RPS15)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.081
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S16 (RPS15A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.025
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S17 (RPS16)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.051
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S19 (TUBB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.050
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S2 (RPS19)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S20 (RPS2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S24 (RPS20)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S25 (RPS24)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.096
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S27-like (RPS26)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S28 (RPS27L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.071
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S3 (VPS52)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.011
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S3a (RPS3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.002
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S6 (RPS5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.017
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
40S ribosomal protein S8 (RPS7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.069
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
60S acidic ribosomal protein P2 (RPLP0)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.031
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
60S ribosomal protein L18 (H3-2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.051
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
60S ribosomal protein L26 (RPL24)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.068
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
60S ribosomal protein L35 (RPL34)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.037
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
60S ribosomal protein L35a (RPL35)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.055
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
ADP-ribosylation factor 5 (ARF5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.004
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Alpha-actin-1 (ACTA)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.042
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Annexin A2 (ANXA2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.043
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Antiapoptosis clone 11 protein (AAC-11)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Apoptotic chromatin condensation inducer in the nucleus (Acinus)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.023
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
ATP-dependent RNA helicase DDX5 (DDX5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.070
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
AU-rich element RNA-binding protein 1 (AUF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.085
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Bcl-2-associated transcription factor 1 (Btf)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.002
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Bcl-2-associated transcription factor 1 (Btf)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.027
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Butyrate-induced protein 1 (B-ind1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Bystin (ENP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.090
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Calpastatin (CAST)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.061
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
CCAAT-box-binding transcription factor (CBF)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.025
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Cellular nucleic acid-binding protein (CNBP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Cholestenol delta-isomerase (EBP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.066
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Cleavage factor Im complex 59 kDa subunit (CFIm59)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.041
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Cleavage factor Im complex 68 kDa subunit (CFIm68)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Cleavage stimulation factor subunit 3 (CstF-77)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Coiled-coil domain-containing protein 124 (CCDC124)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.062
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Cold shock domain-containing protein E1 (CSDE1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.036
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Cold-inducible RNA-binding protein (CIRBP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Connexin-25 (Cx25)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.081
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
CPE-binding protein 4 (hCPEB-4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.047
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
CSTF 64 kDa subunit tau variant (TauCstF-64)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.077
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Cullin-9 (CUL9)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.001
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Cytovillin (EZR)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.037
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DEAD box protein 10 (DDX10)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.091
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DEAD box protein 31 (DDX31)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.093
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DEAD box protein 47 (PHB2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DEAD box protein 56 (DDX56)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.053
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DEAD box protein 6 (DDX6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.097
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DEAD box protein 60-like (DDX60L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DEAH box protein 30 (KIAA0890)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DEAH box protein 8 (DHX8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.083
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Desmocollin-3 (DSC3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Desmoyokin (PM227)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.017
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Dimethyladenosine transferase 2 (TFB2M)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.096
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DNA dC->dU-editing enzyme APOBEC-3F (A3F)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.055
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DNA-directed RNA polymerase (POLRMT)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.024
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
DNA-directed RNA polymerase II subunit RPB2 (POLR2B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.036
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Double-stranded RNA-binding protein Staufen homolog 1 (STAU1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.025
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Double-stranded RNA-binding protein Staufen homolog 2 (STAU2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Double-stranded RNA-specific adenosine deaminase (ADAR)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.036
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Down-regulated in human cancers protein (HELZ)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.041
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Down-regulated in metastasis protein (UTP20)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.033
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Dual specificity protein phosphatase 11 (DUSP11)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.056
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
E1B-55 kDa-associated protein 5 (E1B-AP5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
E3 ubiquitin-protein ligase TRIM56 (TRIM56)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.028
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
E3 ubiquitin/ISG15 ligase TRIM25 (TRIM25)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
EBNA2 coactivator p100 (SND1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.001
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
eIF-2-alpha (EIF2S1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.030
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
EIF4E messenger RNA (EIF4E)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.022
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Elongation factor 1-delta (EEF1D)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			8 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.002
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Elongation factor 1-delta (EEF1D)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.078
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Elongation factor 1-gamma (RBM15B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.037
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Elongation factor 2 (EEF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.087
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ephrin type-B receptor 6 (EPHB6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.095
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Epiplakin (GATAD2B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.091
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Epithelial splicing regulatory protein 1 (ESRP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Epithelial splicing regulatory protein 2 (ESRP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Eukaryotic initiation factor 4A-III (EIF4A3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Eukaryotic initiation factor 5A2 (EIF5A2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.096
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Eukaryotic peptide chain release factor subunit 3a (eRF3a)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.093
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Eukaryotic translation initiation factor 3 subunit C (EIF3C)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.043
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Eukaryotic translation initiation factor 3 subunit D (EIF3D)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.037
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Eukaryotic translation initiation factor 3 subunit E (EIF3E)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Eukaryotic translation initiation factor 3 subunit G (EIF3G)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.051
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Eukaryotic translation initiation factor 4H (EIF4H)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Exosome complex component RRP4 (EXOSC2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.014
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Far upstream element-binding protein 1 (FUBP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.061
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Far upstream element-binding protein 2 (KHSRP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.017
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
FAST kinase domain-containing protein 2 (FASTKD2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.043
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Filamin A (FLNA)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
G-rich sequence factor 1 (GRSF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.037
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Galectin-4 (PSME1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.061
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
GAP SH3 domain-binding protein 2 (G3BP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
GAP SH3 domain-binding protein 2 (G3BP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Gem-associated protein 5 (GEMIN5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.000
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Gene trap ankyrin repeat protein (GTAR)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.028
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Glycine-rich protein (GRP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.061
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Glycoprotein p43 (RBMX)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.023
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
GRB10-interacting GYF protein 2 (GIGYF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.040
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
GTP-binding protein 1 (DRG-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.004
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
GTP-binding protein 1 (GTPBP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.004
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
GTPase Era, mitochondrial (ERAL1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Guanine nucleotide-binding protein-like 3-like protein (GNL3L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.050
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
HCV NS5A-binding protein 37 (FNDC3B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heat shock 70 kDa protein 1B (HSPA1B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.031
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heat shock 70 kDa protein 6 (HSPA6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.019
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heat shock protein 90 beta (HSP90B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.092
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Helicase MOV-10 (MOV10)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Helicase-like protein 2 (HLP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.068
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heterogeneous nuclear ribonucleoprotein H (HNRNPH1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.053
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heterogeneous nuclear ribonucleoprotein L-like (HNRNPLL)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.070
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Heterogeneous nuclear ribonucleoprotein R (RUVBL1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.038
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
hFXR1p (FXR1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.025
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
hFXR2p (FXR2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.011
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Histone deacetylase complex subunit SAP18 (SAP18)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.029
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Histone H2A type 1-J (TMEM200C)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.037
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Histone H3.2 (H2BC18)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.084
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
hnRNP core protein A1-like 2 (HNRNPA1L2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.056
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
HUMAN la-related protein 1 (LARP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
IF-4-gamma 2 (EIF4G2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.079
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
IGF2-binding protein 2 (IMP-2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.011
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
IGF2-binding protein 3 (IMP-3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.017
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Intracellular hyaluronan-binding protein 4 (HABP4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.011
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Iron-inhibited ABC transporter 2 (ABCF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.033
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Keratin, type I cytoskeletal 18 (KRT18)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.042
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Keratin-associated protein 13-1 (KRTAP13-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.022
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Laminin receptor 37/67kDa (LRP/LR)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.030
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Leukophysin (LKP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.037
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
LIM and SH3 domain protein 1 (LASP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
LINE retrotransposable element 1 (L1ORF1p)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.070
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
M phase phosphoprotein 10 (MPHOSPH10)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.035
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Malate dehydrogenase, mitochondrial (MDH2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.070
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Mammalian suppressor of tau pathology-2 (MSUT-2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.088
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Metastasis adhesion protein (MTDH)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Methyltransferase-like protein 16 (METTL16)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.095
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Microtubule-associated protein 4 (MAP4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.097
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
MLK-related kinase (MLTK)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.092
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
mRNA decay activator protein ZFP36 (ZFP36)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
mRNA decay activator protein ZFP36L2 (ZFP36L2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.001
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
mRNA turnover protein 4 homolog (MRTO4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Msx2-interacting protein (SPEN)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Muscleblind-like protein 1 (MBNL2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.035
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Myosin-9 (MYH9)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Negative regulator of transcription subunit 1 (NOT1H)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
NFX1-type zinc finger-containing protein 1 (ZNFX1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.028
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Novel nuclear protein 1 (RRP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.014
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Nuclear cap-binding protein subunit 3 (C17orf85)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.028
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Nuclear protein NHN1 (ZC3H18)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Nuclear receptor coactivator 5 (NCOA5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.054
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Nuclear RNA export factor 1 (NXF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.002
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Nucleolar protein 16 (NOP16)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.072
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Nucleolar protein NAP57 (DKC1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.049
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
OTU domain-containing protein 4 (OTUD4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.020
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Oxidative stress-associated Src activator (OSSA)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
PAI1 RNA-binding protein 1 (PAI-RBP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.004
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Pentatricopeptide repeat-containing protein 1 (KIAA0632)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.053
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Peptidyl-prolyl cis-trans isomerase G (PPIG)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Peroxiredoxin-1 (PRDX1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.002
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Pescadillo homolog (PES1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.023
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Phosphatidylethanolamine-binding protein 1 (PEBP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.056
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Pinin (PNN)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.042
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Polyadenylate-binding protein 4 (PABPC4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Polynucleotide 5'-hydroxyl-kinase NOL9 (NOL9)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.016
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Positive cofactor 4 (PC4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.066
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Probable rRNA-processing protein EBP2 (EBNA1BP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.076
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Profilin-1 (PFN1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.017
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Proliferation-associated protein 2G4 (PA2G4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein AHNAK2 (AHNAK2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.070
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein bicaudal C homolog 1 (BICC1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.030
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein CASC3 (CASC3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.035
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein disulfide-isomerase A3 (PDIA3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein FAM50A (FAM50A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.019
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein FAM98B (FAM98B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.084
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein LSM14 homolog A (EPPK1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.025
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein LSM14 homolog B (LSM14B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.022
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein PAT1 homolog 1 (PATL1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.020
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein phosphatase type-1 glycogen targeting (PPP1R3A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.080
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein quaking (QKI)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.084
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Protein SON (SON)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.073
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Pseudouridylate synthase RPUSD4 (RPUSD4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Pumilio homolog 2 (PUM2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.043
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Pumilio homolog 2 (PUM2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.051
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Putative heat shock protein HSP 90-beta 2 (SMARCAD1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.040
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Putative methyltransferase C9orf114 (SHROOM4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.090
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Putative RNA-binding protein 15B (BOP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Putative S1 RNA-binding domain protein (PS1D)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
R3H domain-containing protein 1 (R3HDM1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.016
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
R3H domain-containing protein 1 (R3HDM1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
R3H domain-containing protein 2 (R3HDM2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.030
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Regulator of nonsense transcripts 1 (NORF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Retrotransposon-derived protein PEG10 (NME2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.081
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ribosomal biogenesis protein LAS1L (LAS1L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.070
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ribosomal L1 domain-containing protein 1 (RSL1D1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.096
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ribosomal RNA processing protein 36 homolog (RRP36)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.014
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ribosomal RNA-processing protein 8 (RRP8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.059
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ribosome biogenesis protein BOP1 (RBM8A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.059
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ribosome biogenesis protein NSA2 homolog (NSA2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.023
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ribosome production factor 2 homolog (RPF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.079
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RING finger protein 194 (MEX3C)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RING finger protein unkempt homolog (UNK)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.051
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA binding motif protein, X-linked-like-1 (DDX47)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.090
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA helicase-related protein (RNAHP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.014
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 12 (PGAM5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.058
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 12B (RBM12B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.044
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 15 (RBM15)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.011
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 27 (RBM27)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.084
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 28 (RBM28)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.084
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 3 (RBM3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 33 (RBM33)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.061
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 39 (RBM39)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.047
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 45 (RBM45)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.068
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 47 (RBM47)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.014
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 7 (RBM7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.004
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein 8A (TAF15)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein FUS (FUS)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.059
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-binding protein MEX3D (MEX3D)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.016
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-directed RNA polymerase II subunit RPB1 (ITIH5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.100
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RNA-splicing ligase RtcB homolog (RTCB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			8 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.025
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Roquin-1 (RC3H1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.022
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Rotamase A (PPIA)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Rotamase B (PPIB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.020
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Rotavirus 'X'-associated non-structural protein (RoXaN)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.016
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
rRNA methyltransferase 1 (SURF4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
rRNA-processing protein FCF1 homolog (FCF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.071
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
RRP15-like protein (RRP15)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.096
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
SAM domain-containing protein 9 (SERPINB4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Sam68-like mammalian protein 2 (SLM-2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.099
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
SAP domain-containing ribonucleoprotein (RNPS1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Scaffold attachment factor B1 (SAFB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.097
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Scaffold attachment factor B2 (SAFB2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.053
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
SECIS-binding protein 2 (SECISBP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.092
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
SECIS-binding protein 2-like (SECISBP2L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.085
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Sequestosome-1 p62 (SQSTM1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.004
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Serine-rich spermatocytes and round spermatid 59 (SPATS2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.046
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Serine/arginine repetitive matrix protein 1 (SRRM1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.071
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Serine/arginine-rich splicing factor 1 (SRSF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Serine/arginine-rich splicing factor 2 (SRSF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Serine/arginine-rich splicing factor 5 (SRSF5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Serine/arginine-rich splicing factor 6 (SRSF6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Serine/arginine-rich splicing factor 7 (SRSF7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.007
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Serine/arginine-rich splicing factor 9 (SRSF9)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.032
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Serpin B12 (SERPINB12)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.056
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Serrate RNA effector molecule homolog (SRRT)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.030
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Single-stranded DNA-binding protein (SSBP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Small arginine- and glycine-rich protein (SRAG)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.011
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Small nuclear ribonucleoprotein G (SNRPG)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.078
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Small ribosomal subunit protein eS12 (RPS12)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.005
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Small ubiquitin-related modifier 1 (SUMO1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.007
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
snoRNP protein GAR1 (GAR1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.052
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
snoRNP protein NHP2 (NHP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.059
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
SNW domain-containing protein 1 (SNW1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.014
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
SPATS2-like protein (SPATS2L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.031
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Splicing factor U2AF 35 kDa subunit (U2AF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.079
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Splicing factor U2AF 65 kDa subunit (U2AF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.031
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
SR-related protein LDC2 (SACM1L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Suppressor of SWI4 1 homolog (PPAN)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.048
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Synaptic functional regulator FMR1 (FMR1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.023
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
TAR DNA binding protein 43 (TARDBP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.051
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Tat-cotransactivator 2 protein (SUPT6H)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Thyroid hormone receptor-associated protein 3 (THRAP3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.003
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Transcriptional activator protein Pur-beta (PURB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.022
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Transformer-2 protein homolog alpha (TRA2A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.056
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Transformer-2 protein homolog beta (TRA2B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.025
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Transportin-2 (TNPO2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.072
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Trinucleotide repeat-containing gene 6B protein (TNRC6B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.039
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
TRMT1-like protein (TRMT1L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.084
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
tRNA methyltransferase 10 homolog C (TRMT10C)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.030
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
tRNA methyltransferase 112 homolog (TRMT112)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.026
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
TTF-1-associated protein 26 (CCDC59)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.093
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
U1 snRNP 70 kDa (SNRNP70)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.025
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
U3 snoRNA-associated protein 11 (ZNF680)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.059
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
U3 snoRNP protein IMP4 (IMP4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.031
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ubiquitin carboxyl-terminal hydrolase 10 (USP10)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.002
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ubiquitin-associated protein 2 (UBAP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Ubiquitin-associated protein 2-like (UBAP2L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.097
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Uncharacterized protein C7orf50 (C7orf50)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.071
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
UPF0696 protein C11orf68 (C11orf68)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Valine--tRNA ligase (VARS)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.011
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
WD repeat-containing protein 50 (UTP18)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
WIBG protein (WIBG)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.022
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
YLP motif-containing protein 1 (YLPM1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.042
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
YTH domain-containing family protein 2 (YTHDF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.006
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
YTH domain-containing family protein 3 (YTHDF3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.012
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
YTH domain-containing protein 1 (YTHDC1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.008
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
YTH domain-containing protein 2 (hYTHDC2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.037
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Zinc finger CCCH domain-containing protein 11A (ZC3H11A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.013
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Zinc finger CCCH domain-containing protein 7A (ZC3H7A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.056
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Zinc finger CCCH domain-containing protein 8 (ZC3H8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.022
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Zinc finger CCCH-type antiviral protein 1 (ZC3HAV1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.100
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)
Zinc finger protein 622 (ZNF622)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Time			24 h
Infection Cells			Calu-3 cells (Human lung cancer cell)  (CVCL_0609 )
Cell Originated Tissue			Lung
Interaction Score			P-adjust = 0.043
Description of Detection Method			UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS)

Virus RNA Sequence Information (Source: GISAID)

>hCoV-19/England/02/2020|EPI_ISL_407073|2020-01-29 AGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCT GTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACG AGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTCGTCC GGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTT TTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAA AGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTT CGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTCGTAGT GGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAGAACGG TAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGATCCTT ATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACGGAGGG GCATACACTCGCTATGTCGATAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACG TGCTGGTAAAGCTTCATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAAC ATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCA AAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAACCAAG GGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCACCAAATGAATGCAACC AAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCAGACGGGCGATTTTGTTAAAGCCACT TGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAAATGCTGTTGTTAA AATTTATTGTCCAGCATGTCACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGGCTTGA AAACCATTCTTCGTAAGGGTGGTCGCACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACAAGTGT GCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGTCTTAA TGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGAGATCG CCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGATTATAAAGCATTCAAA CAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAGGTGCCTGGAATATTGGTGAACAGAA ATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCGTGTTGTACGATCAATTTTCTCCCGCACTCTTGAAA CTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCCGCTATAACAATACTAGATGGAATTTCACAGTATTCACTGAGACTC ATTGATGCTATGATGTTCACATCTGATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTTGTTCA GTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGAAGAGA AGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAATTGTC GGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGTAAATAAATTTTTGGC TTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTAGGTGAAACATTTGTCACGCACTCAA AGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCCTACTCATGCCTCTAAAAGCCCCAAAAGAAATTATC TTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTTAACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCATTAGA ACAACCTACTAGTGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGAAATCA AAGACACAGAAAAGTACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTGCACCA ACAAAGGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTTGATGA AAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAAATGAGTTCGCCTGTG TTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACCACTGGGCATTGATTTAGATGAGTGG AGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAATTGGCTTCACATATGTATTGTTCTTTCTACCCTCC AGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAGAAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGAAGATG ATTACCAAGGTAAACCTTTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTA GATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTTGA GGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTTAAAAC TTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAACCAACAGTGGTTGTTAATGCA GCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTACTAACAATGCCATGCAAGTTGAATC TGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAAACACT GTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAATCAG CACGAAGTTCTACTTGCACCATTATTATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGTGTAGA TACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGAAATGA AGAGTGAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTAAACCT TCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAAACTAA GTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCAGATTCTGCCACTCTTGTTAGTGACA TTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTT ATACCTACTAAAAAGGCTGGTGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAAC CACTTACCCGGGTCAGGGTTTAAATGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCCTTTT ACATTCTACCATCTATTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGCTTGCA CATGCAGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAATATAA GGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAACAACTGTAGCGTCAC TTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTATGTAACACATGGCTTAAATTTGGAA GAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCGTATAA TGGTTATCTTACTTCTTCTTCTAAAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAAAGATT GGTCCTATTCTGGACAATCTACACAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTAGTAAT CCTACCACATTCCACCTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTGAGGAC TATTAAGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACAACAGT TTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGTAAAACATTTTATGTT TTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTGATCCTAGTTTTCTGGGTAGGTACAT GTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAACAACT GTTATCTTGCCACTGCATTGTTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTAC AGAGCAAGGGCTGGTGAAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGA TGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTGTAAAA CTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAATTTAAG AAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTCACCTTTTGTTATGAT GTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGTGAGTACACTGGTAATTACCAGTGTG GTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAA GGTCCTATTACGGATGTTTTCTACAAAGAAAACAGTTACACAACAACCATAAAACCAGTTACTTATAAATTGGATGGTGT TGTTTGTACAGAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAATTGATC TTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTGATGAT TTAAACCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGTGATGT GGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAACCTATTGTTTGGCATG TTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTGTCTTTGGAGCACAAAACCAGTTGAA ACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAACCAGT CTCTGAAGAAGTAGTGGAAAATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAG ACATTATACTTAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTA GACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCATGGTTT AGCTGCTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTACAACTA CTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTATTGCTACAATTGTGT ACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAGCAAAGAATACTGTTAAGAGTGTCGG TAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTATAATTTGGTTTT TACTATTAAGTGTTTGCCTAGGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCT TCTTACTGTACTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACC TTGTAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTCATCTT TTAAATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCTATGTA CTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTCTTGGCTTATGTGGTT AATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATCTTCTTTGCATCATTTTATTATGTAT GGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAACAAGA GTCGAATGTACAACTATTGTTAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAAACT ACACAATTGGAATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGT CACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATGGTTCC ATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGACAACCT GAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAATGTGAAGAATCATCTG CAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACTAGATCAGGCATTAGTGTCTGATGTT GGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCAATGGA AAAACTCAAAACACTAGTTGCAACTGCAGAAGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTTA TTTCAGCAGCTCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACATCAA TCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCCCGTGA CCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGATATGGA ACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAGAATAACTTACCTTTT AAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAGCACTTAAGGGTGGTAAAATTGTTAA TAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACCTGTTC ATGTCATGTCTAAACATACTGACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACATA GCATCTACAGATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGTCAGCGTGGTGGTAGTTATACTAA TGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCACGATAT TACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACACCATCA AAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTTTAAAGATGCTTCTGG TAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTATGAAAGTTTACGCCCTGACACACGTT ATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTTTTGAT TCTGAGTACTGTAGGCACGGCACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTACTTAA CAATGATTATTACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTACACCAC TAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACATGCCTT GCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTCCTTAT GTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTTACTTGTACTTGACAT TTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTTCACACCTTTAGTACCTTTCTGGATA ACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTAGTCTT TAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAAGTTGC GTAGTGATGTGCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCA ATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGTTCTGA TGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCCATCTG GTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTTGATGACGTAGTTTAC TGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAGATTTACTCATTCGTAAGTCTAATCA TAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCTTAAGG TTGATACAGCCAATCCTAAGACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAGCTTGT TACAATGGTTCACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAATGGTTC ATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAACTGGAG TTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTACGGAC ACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTTTCTCAATCGATTTAC CACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTAACACAAGACCATGTTGACATACTAG GACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAATGGTATGAAT GGACGTACCATATTGGGTAGTGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGTGTTAC TTTCCAAAGTGCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAGTTT TAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTATTGCT ATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCCACTGT AGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATATGGTTGATACTAGTT TGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACTAATCCTTATGACAGCAAGAACTGTG TATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTT AGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCATGTTTT TGGCCAGAGGTATTGTTTTTATGTGTGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTATAATG CTAGTTTATTGTTTCTTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGACTGAC TCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAAGAATA GCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTAGCCACTGTACAGTCT AAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCATCTAAATT GTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAAAGATACTACTGAAGCCTTTGAAAAAATGGTTTCAC TACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTAGACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGGCAACC TTACAAGCTATAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAGCAGGC TGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGACCGTG ATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTGAGGAC AAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAATGATGCACTCAACAA CATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACAACAGCAGCCAAACTAATGGTTGTCA TACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACATTTACTTATGCATCAGCATTGTGGGAAATCCAACAG GTTGTAGATGCAGATAGTAAAATTGTTCAACTTAGTGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCTCTTAT TGTAACAGCTTTAAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTT GTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTAGGTTT GTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATCTATAC AGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTATACTTTATTAAAGGAT TAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCTACAAGCTGGTAATGCAACAGAAGTG CCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGG GGGACAACCAATCACTAATTGTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACCGGAAG CCAATATGGATCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAA GGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAA CACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAG CTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTG ATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTTGTCGC TTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAACA TGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTG ACATGGTACCACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGAT GAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAGGACTG GTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTTAAAAA CAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAAGATCTCAATGGTAAC TGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTGTTAAT GCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAAGTGGG ATTTGTTAAAATATGACTTCACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCAC CCAAATTGTGTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCCC ACCTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCACTTCA GAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGTATGCT GCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTCAGTAGCTGCACTTAC TAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGGTTTCT TTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATGACTAC TATCGTTATAATCTACCAACAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTG TTACGATGGTGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAAT GGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTAATGTC ATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTCTCTAT CTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAGGAGCTACTGTAGTAA TTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTAGAAAACCCTCACCTTATG GGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGCAAACA TACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGT GTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAAC ATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGCAA TTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGCATATT TGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTATGCATCTCAAGGTCTA GTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGGACTGA GACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGTGTACC TTCCTTACCCAGATCCATCAAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATG ATTGAACGGTTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTCA TTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCTTACTA ATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTGTTGGG GCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTTATGTTGTAAATGCTG TTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTATGTTTGCAATGCTCCAGGTTGTGATG TCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATTGTAAATCACATAAACCACCCATTAGTTTTCCATTG TGTGCTAATGGACAAGTTTTTGGTTTATATAAAAATACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCAATTGC AACATGTGACTGGACAAATGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGCAGAAA CGCTCAAAGCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAGAATTA CATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACTAAAAA CAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACCGAGGTACAACAACTT ACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATTAAGTGCACCTACACTAGTGCCACAA GAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATCTCAGATGAGTTTTCTAGCAATGTTGCAAATTATCA AAAGGTTGGTATGCAAAAGTATTCTACACTCCAGGGACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCTAGCTC TCTACTACCCTTCTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCATTAAAA TATTTGCCTATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTGAATTC AACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGAAATTT CAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTACATTGGCGACCCTGCT CAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAA AACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTT ATGATAATAAGCTTAAAGCACATAAAGACAAATCAGCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGCATGAT GTTTCATCTGCAATTAACAGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAAGCTGT CTTTATTTCACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTCATCAC AGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTAATGTT GCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTTGCAATTTACAAGTCT TGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGTAATCA CTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTGACATA CCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTA CCCTAACATGTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTGTCATG CTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTACCTACA GGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAACACCT CACACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAAGTGACACACTTAAAA ATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATCTATGAAGTATTTTGTGAAAATAGGA CCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGGCATCA TTCTATTGGATTTGATTACGTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCA ACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTC CACGAGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCGGCTTG TAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAACCCTA AAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGTGACAAAGCTTATAAA ATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTGTATGCCTATTTTGGAATTGCAATGT CGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTGTGATG GTGGCAGTTTGTATGTAAATAAACATGCATTCCACACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAACAATTA CCATTTTTCTATTACTCTGACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCACTAAA GTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTATCTCG ATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGAACACT TTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGGACAACAGGGTGAAGT ACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTAGAATTGTTTGAAAATAAAACAACAT TACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTAAACCAGTACCAGAGGTGAAAATACTCAATAATTTG GGTGTGGACATTGCTGCTAATACTGTGATCTGGGACTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGTGTTTG TTCTATGACTGACATAGCCAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGTTGATG GTCAAGTAGACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCATCTGTA GGTCCCAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAGAAAGT TGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTAAACCCAGGAGTCAAA TGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATTAGAAGGCTATGCCTTCGAACATATC GTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAATCACC TTTTGAATTAGAAGATTTTATTCCTATGGACAGTACAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTCATCTA AGTGTGTGTGTTCTGTTATTGATTTATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAGTTTCT AAGGTTGTCAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACATTTTA CCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCTATTAG AAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTCGCAAAATATACTCAA CTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTATACATTTTGGTGCTGGTTCTGATAA AGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTACGGGTACGCTGCTTGTCGATTCAGATCTTAATGACT TTGTCTCTGATGCAGATTCAACTTTGATTGGTGATTGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTATTAGT GATATGTACGACCCTAAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGTGGGTT TATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGC TCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGT AATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCC AATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAA AAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTT ATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGT GTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAA GTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTAT ACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCA CTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAAT AACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAA CAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTT TTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTT AAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGA TTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTT CTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAA AATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGT AGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACT TGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGT GTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAA TGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAA CTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTT GATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATAT TTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCAT ATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCA GCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGG CACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATG CTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGA ACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCA ACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAAC ATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCG CGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTC TAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACAT CAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACA CAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAAT TTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGA GGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGCCTT GGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGA AATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTAC AAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAAAAA TTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACT TCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAA GTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTT CAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCTACTAA AATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCCTCAGT CAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTGCCATT TGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAAAGGAA TTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACA ACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCA CCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGA GGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCCATGGT ACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTTGCTGT AGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGT CAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGAATCTTCACAATTGGAACTGTAACTTTGAAGCAAGG TGAAATCAAGGATGCTACTCCTTCAGATTTTGTTCGCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTTCGGAT GGCTTATTGTTGGCGTTGCACTTCTTGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGCAACTA GCACTCTCCAAGGGTGTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTCGTTGC TGCTGGCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAATAATAA TGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTTCTTTGCTGGCATACT AATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTACTTCAGGTGATGGCACAACAAGTCC TATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATGGGAATCTGGAGTAAAAGACTGTGTTGTATTACACA GTTACTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCTTCTTC ATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCC AGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTA TGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTG CTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACC TTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAAACGAACTAAATAT TATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCTTAAAA AGCTCCTTGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATGCCAAC AGGAATAGGTTTTTGTATATAATTAAGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTGCTTGC TGCTGTTTACAGAATAAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCTCAGCT ACTTCATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTCTCAAC GTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGTGATCCTTCGTGGACA TCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAAGAAATCACTGTTGCTACATCACGAA CGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTGACTCAGGTTTTGCTGCATACAGTCGCTACAGGATT GGCAACTATAAATTAAACACAGACCATTCCAGTAGCAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACAGATGT TTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTTGGAAT CTTGATTACATCATAAACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGATGAAGA GCAACCAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGAGCTTT ATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACATACGAGGGCAATTCA CCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAATTTGCTTTTGCTTGTCCTGACGGCGT AAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACTGTTCATCAGACAAGAGGAAGTTCAAGAACTTTACT CTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTTATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGATTGAAC TTTCATTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTTGGTTC TCACTTGAACTGCAAGATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATCATCAC AACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCCGTGTC CTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAATTGTGCGTGGATGAG GCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCTGTTCACCTTTTACAATTAATTGCCA GGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGAAGACTTTTTAGAGTATCATGACGTTCGTGTTGTTT TAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTG GTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGT TTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGG CGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTG ACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGT GCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCC TGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAG GCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGA ACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGA GAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGC CTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGA AATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGC TTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCA AATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCA CCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAAC TGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTC AGGCCTAAACTCATGCAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATGTATAGTCTA CTCTTGTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCTTTAAT CAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGTACAGT GAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCATGTG     Click to Show/Hide

References
1	Global analysis of protein-RNA interactions in SARS-CoV-2-infected cells reveals key regulators of infection. Mol Cell. 2021 Jul 1;81(13):2851-2867.e7.