Details of Virus RNA
| Virus RNA General Information | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Strain Information | Strain Name |
hCoV-19/England/02/2020
|
|||||||
| Strain Family |
Beta (B.1.351)
|
||||||||
| GISAID Accession |
EPI_ISL_407073
Info
Collection Date: 2020/1/29
Originating Lab: Respiratory Virus Unit, Microbiology Services Colindale, Public Health England
Submitting Lab: Respiratory Virus Unit, Microbiology Services Colindale, Public Health England
Authors: Monica Galiano, Shahjahan Miah, Richard Myers, Angie Lackenby, Omolola Akinbami, Tiina Talts, Leena Bhaw, Kirstin Edwards, Jonathan Hubb, Joanna Ellis, Maria Zambon.
|
EPI_SET ID | EPI_SET_220823ya | ||||||
| RNA Binding Site |
Not Specified Virus Region
|
||||||||
| Virus Information | Virus Name |
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
|
|||||||
| Taxonomy ID | 2697049 | ||||||||
| Virus RNA - Host Protein Network | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Regulation Network | |||||||||
| Full list of proteins interacting with the Not Specified Virus Region of this Strain | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| hnRNP A1 messenger RNA (HNRNPA1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.030 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| IGF2-binding protein 1 (IMP-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.033 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| APOBEC1-binding protein 1 (HNRNPAB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.056 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| hnRNP A2/B1 messenger RNA (HNRNPA2B1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.093 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Spliceosome RNA helicase DDX39B (EXOSC6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.010 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Lipopolysaccharide-associated protein 1 (HSPA8) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein L (LGALS4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.059 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein K (HNRNPK) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.095 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein Q (SYNCRIP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.037 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.007 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoproteins C1/C2 (HNRNPC) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S7 (RPS6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| NonO protein (NONO) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.064 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 14-3-3 protein zeta/delta (KCIP-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.096 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 28S ribosomal protein S23 (MRP-S23) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.033 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 28S ribosomal protein S31 (Imogen 38) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.046 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 28S ribosomal protein S5 (S5mt) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.030 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 28S ribosomal protein S7 (MRP-S7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.059 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 39S ribosomal protein L13 (MRP-L13) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.029 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 39S ribosomal protein L3 (MRP-L3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.020 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 39S ribosomal protein L37 (L2mt) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.076 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S11 (RPS10) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.004 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S14 (RPS11) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.009 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S15 (RPS14) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.004 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S15a (RPS15) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.081 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S16 (RPS15A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.025 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S17 (RPS16) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.051 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S19 (TUBB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.050 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S2 (RPS19) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S20 (RPS2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S24 (RPS20) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S25 (RPS24) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.096 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S27-like (RPS26) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S28 (RPS27L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.071 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S3 (VPS52) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.011 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S3a (RPS3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.002 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S6 (RPS5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.017 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 40S ribosomal protein S8 (RPS7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.069 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 60S acidic ribosomal protein P2 (RPLP0) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.031 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 60S ribosomal protein L18 (H3-2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.051 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 60S ribosomal protein L26 (RPL24) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.068 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 60S ribosomal protein L35 (RPL34) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.037 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| 60S ribosomal protein L35a (RPL35) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.055 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| ADP-ribosylation factor 5 (ARF5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.004 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Alpha-actin-1 (ACTA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.042 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Annexin A2 (ANXA2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.043 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Antiapoptosis clone 11 protein (AAC-11) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Apoptotic chromatin condensation inducer in the nucleus (Acinus) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.023 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| ATP-dependent RNA helicase DDX5 (DDX5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.070 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| AU-rich element RNA-binding protein 1 (AUF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.085 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Bcl-2-associated transcription factor 1 (Btf) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.002 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Bcl-2-associated transcription factor 1 (Btf) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.027 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Butyrate-induced protein 1 (B-ind1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Bystin (ENP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.090 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Calpastatin (CAST) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.061 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| CCAAT-box-binding transcription factor (CBF) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.025 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Cellular nucleic acid-binding protein (CNBP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Cholestenol delta-isomerase (EBP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.066 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Cleavage factor Im complex 59 kDa subunit (CFIm59) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.041 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Cleavage factor Im complex 68 kDa subunit (CFIm68) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Cleavage stimulation factor subunit 3 (CstF-77) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Coiled-coil domain-containing protein 124 (CCDC124) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.062 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Cold shock domain-containing protein E1 (CSDE1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.036 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Cold-inducible RNA-binding protein (CIRBP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Connexin-25 (Cx25) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.081 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| CPE-binding protein 4 (hCPEB-4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.047 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| CSTF 64 kDa subunit tau variant (TauCstF-64) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.077 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Cullin-9 (CUL9) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.001 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Cytovillin (EZR) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.037 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DEAD box protein 10 (DDX10) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.091 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DEAD box protein 31 (DDX31) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.093 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DEAD box protein 47 (PHB2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DEAD box protein 56 (DDX56) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.053 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DEAD box protein 6 (DDX6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.097 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DEAD box protein 60-like (DDX60L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DEAH box protein 30 (KIAA0890) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DEAH box protein 8 (DHX8) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.083 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Desmocollin-3 (DSC3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Desmoyokin (PM227) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.017 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Dimethyladenosine transferase 2 (TFB2M) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.096 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DNA dC->dU-editing enzyme APOBEC-3F (A3F) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.055 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DNA-directed RNA polymerase (POLRMT) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.024 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| DNA-directed RNA polymerase II subunit RPB2 (POLR2B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.036 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Double-stranded RNA-binding protein Staufen homolog 1 (STAU1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.025 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Double-stranded RNA-binding protein Staufen homolog 2 (STAU2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Double-stranded RNA-specific adenosine deaminase (ADAR) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.036 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Down-regulated in human cancers protein (HELZ) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.041 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Down-regulated in metastasis protein (UTP20) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.033 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Dual specificity protein phosphatase 11 (DUSP11) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.056 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| E1B-55 kDa-associated protein 5 (E1B-AP5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| E3 ubiquitin-protein ligase TRIM56 (TRIM56) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.028 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| E3 ubiquitin/ISG15 ligase TRIM25 (TRIM25) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| EBNA2 coactivator p100 (SND1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.001 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| eIF-2-alpha (EIF2S1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.030 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| EIF4E messenger RNA (EIF4E) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.022 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Elongation factor 1-delta (EEF1D) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 8 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.002 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Elongation factor 1-delta (EEF1D) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.078 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Elongation factor 1-gamma (RBM15B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.037 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Elongation factor 2 (EEF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.087 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ephrin type-B receptor 6 (EPHB6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.095 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Epiplakin (GATAD2B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.091 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Epithelial splicing regulatory protein 1 (ESRP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Epithelial splicing regulatory protein 2 (ESRP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Eukaryotic initiation factor 4A-III (EIF4A3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Eukaryotic initiation factor 5A2 (EIF5A2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.096 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Eukaryotic peptide chain release factor subunit 3a (eRF3a) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.093 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Eukaryotic translation initiation factor 3 subunit C (EIF3C) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.043 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Eukaryotic translation initiation factor 3 subunit D (EIF3D) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.037 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Eukaryotic translation initiation factor 3 subunit E (EIF3E) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Eukaryotic translation initiation factor 3 subunit G (EIF3G) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.051 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Eukaryotic translation initiation factor 4H (EIF4H) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Exosome complex component RRP4 (EXOSC2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.014 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Far upstream element-binding protein 1 (FUBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.061 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Far upstream element-binding protein 2 (KHSRP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.017 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| FAST kinase domain-containing protein 2 (FASTKD2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.043 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Filamin A (FLNA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| G-rich sequence factor 1 (GRSF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.037 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Galectin-4 (PSME1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.061 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| GAP SH3 domain-binding protein 2 (G3BP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| GAP SH3 domain-binding protein 2 (G3BP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Gem-associated protein 5 (GEMIN5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.000 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Gene trap ankyrin repeat protein (GTAR) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.028 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Glycine-rich protein (GRP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.061 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Glycoprotein p43 (RBMX) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.023 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| GRB10-interacting GYF protein 2 (GIGYF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.040 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| GTP-binding protein 1 (DRG-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.004 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| GTP-binding protein 1 (GTPBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.004 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| GTPase Era, mitochondrial (ERAL1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Guanine nucleotide-binding protein-like 3-like protein (GNL3L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.050 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| HCV NS5A-binding protein 37 (FNDC3B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heat shock 70 kDa protein 1B (HSPA1B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.031 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heat shock 70 kDa protein 6 (HSPA6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.019 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heat shock protein 90 beta (HSP90B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.092 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Helicase MOV-10 (MOV10) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Helicase-like protein 2 (HLP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.068 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein H (HNRNPH1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.053 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein L-like (HNRNPLL) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.070 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Heterogeneous nuclear ribonucleoprotein R (RUVBL1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.038 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| hFXR1p (FXR1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.025 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| hFXR2p (FXR2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.011 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Histone deacetylase complex subunit SAP18 (SAP18) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.029 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Histone H2A type 1-J (TMEM200C) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.037 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Histone H3.2 (H2BC18) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.084 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| hnRNP core protein A1-like 2 (HNRNPA1L2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.056 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| HUMAN la-related protein 1 (LARP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| IF-4-gamma 2 (EIF4G2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.079 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| IGF2-binding protein 2 (IMP-2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.011 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| IGF2-binding protein 3 (IMP-3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.017 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Intracellular hyaluronan-binding protein 4 (HABP4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.011 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Iron-inhibited ABC transporter 2 (ABCF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.033 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Keratin, type I cytoskeletal 18 (KRT18) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.042 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Keratin-associated protein 13-1 (KRTAP13-1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.022 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Laminin receptor 37/67kDa (LRP/LR) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.030 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Leukophysin (LKP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.037 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| LIM and SH3 domain protein 1 (LASP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| LINE retrotransposable element 1 (L1ORF1p) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.070 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| M phase phosphoprotein 10 (MPHOSPH10) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.035 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Malate dehydrogenase, mitochondrial (MDH2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.070 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Mammalian suppressor of tau pathology-2 (MSUT-2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.088 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Metastasis adhesion protein (MTDH) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Methyltransferase-like protein 16 (METTL16) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.095 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Microtubule-associated protein 4 (MAP4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.097 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| MLK-related kinase (MLTK) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.092 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| mRNA decay activator protein ZFP36 (ZFP36) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| mRNA decay activator protein ZFP36L2 (ZFP36L2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.001 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| mRNA turnover protein 4 homolog (MRTO4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Msx2-interacting protein (SPEN) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Muscleblind-like protein 1 (MBNL2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.035 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Myosin-9 (MYH9) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Negative regulator of transcription subunit 1 (NOT1H) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| NFX1-type zinc finger-containing protein 1 (ZNFX1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.028 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Novel nuclear protein 1 (RRP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.014 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Nuclear cap-binding protein subunit 3 (C17orf85) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.028 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Nuclear protein NHN1 (ZC3H18) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Nuclear receptor coactivator 5 (NCOA5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.054 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Nuclear RNA export factor 1 (NXF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.002 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Nucleolar protein 16 (NOP16) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.072 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Nucleolar protein NAP57 (DKC1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.049 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| OTU domain-containing protein 4 (OTUD4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.020 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Oxidative stress-associated Src activator (OSSA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| PAI1 RNA-binding protein 1 (PAI-RBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.004 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Pentatricopeptide repeat-containing protein 1 (KIAA0632) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.053 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Peptidyl-prolyl cis-trans isomerase G (PPIG) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Peroxiredoxin-1 (PRDX1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.002 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Pescadillo homolog (PES1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.023 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Phosphatidylethanolamine-binding protein 1 (PEBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.056 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Pinin (PNN) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.042 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Polyadenylate-binding protein 4 (PABPC4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Polynucleotide 5'-hydroxyl-kinase NOL9 (NOL9) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.016 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Positive cofactor 4 (PC4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.066 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Probable rRNA-processing protein EBP2 (EBNA1BP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.076 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Profilin-1 (PFN1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.017 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Proliferation-associated protein 2G4 (PA2G4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein AHNAK2 (AHNAK2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.070 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein bicaudal C homolog 1 (BICC1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.030 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein CASC3 (CASC3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.035 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein disulfide-isomerase A3 (PDIA3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein FAM50A (FAM50A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.019 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein FAM98B (FAM98B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.084 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein LSM14 homolog A (EPPK1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.025 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein LSM14 homolog B (LSM14B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.022 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein PAT1 homolog 1 (PATL1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.020 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein phosphatase type-1 glycogen targeting (PPP1R3A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.080 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein quaking (QKI) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.084 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Protein SON (SON) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.073 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Pseudouridylate synthase RPUSD4 (RPUSD4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Pumilio homolog 2 (PUM2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.043 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Pumilio homolog 2 (PUM2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.051 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Putative heat shock protein HSP 90-beta 2 (SMARCAD1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.040 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Putative methyltransferase C9orf114 (SHROOM4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.090 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Putative RNA-binding protein 15B (BOP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Putative S1 RNA-binding domain protein (PS1D) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| R3H domain-containing protein 1 (R3HDM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.016 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| R3H domain-containing protein 1 (R3HDM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| R3H domain-containing protein 2 (R3HDM2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.030 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Regulator of nonsense transcripts 1 (NORF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Retrotransposon-derived protein PEG10 (NME2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.081 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ribosomal biogenesis protein LAS1L (LAS1L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.070 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ribosomal L1 domain-containing protein 1 (RSL1D1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.096 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ribosomal RNA processing protein 36 homolog (RRP36) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.014 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ribosomal RNA-processing protein 8 (RRP8) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.059 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ribosome biogenesis protein BOP1 (RBM8A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.059 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ribosome biogenesis protein NSA2 homolog (NSA2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.023 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ribosome production factor 2 homolog (RPF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.079 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RING finger protein 194 (MEX3C) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RING finger protein unkempt homolog (UNK) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.051 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA binding motif protein, X-linked-like-1 (DDX47) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.090 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA helicase-related protein (RNAHP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.014 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 12 (PGAM5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.058 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 12B (RBM12B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.044 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 15 (RBM15) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.011 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 27 (RBM27) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.084 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 28 (RBM28) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.084 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 3 (RBM3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 33 (RBM33) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.061 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 39 (RBM39) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.047 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 45 (RBM45) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.068 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 47 (RBM47) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.014 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 7 (RBM7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.004 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein 8A (TAF15) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein FUS (FUS) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.059 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-binding protein MEX3D (MEX3D) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.016 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-directed RNA polymerase II subunit RPB1 (ITIH5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.100 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RNA-splicing ligase RtcB homolog (RTCB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 8 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.025 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Roquin-1 (RC3H1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.022 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Rotamase A (PPIA) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Rotamase B (PPIB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.020 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Rotavirus 'X'-associated non-structural protein (RoXaN) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.016 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| rRNA methyltransferase 1 (SURF4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| rRNA-processing protein FCF1 homolog (FCF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.071 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| RRP15-like protein (RRP15) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.096 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| SAM domain-containing protein 9 (SERPINB4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Sam68-like mammalian protein 2 (SLM-2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.099 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| SAP domain-containing ribonucleoprotein (RNPS1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Scaffold attachment factor B1 (SAFB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.097 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Scaffold attachment factor B2 (SAFB2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.053 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| SECIS-binding protein 2 (SECISBP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.092 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| SECIS-binding protein 2-like (SECISBP2L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.085 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Sequestosome-1 p62 (SQSTM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.004 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Serine-rich spermatocytes and round spermatid 59 (SPATS2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.046 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Serine/arginine repetitive matrix protein 1 (SRRM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.071 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Serine/arginine-rich splicing factor 1 (SRSF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Serine/arginine-rich splicing factor 2 (SRSF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Serine/arginine-rich splicing factor 5 (SRSF5) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Serine/arginine-rich splicing factor 6 (SRSF6) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Serine/arginine-rich splicing factor 7 (SRSF7) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.007 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Serine/arginine-rich splicing factor 9 (SRSF9) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.032 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Serpin B12 (SERPINB12) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.056 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Serrate RNA effector molecule homolog (SRRT) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.030 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Single-stranded DNA-binding protein (SSBP1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Small arginine- and glycine-rich protein (SRAG) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.011 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Small nuclear ribonucleoprotein G (SNRPG) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.078 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Small ribosomal subunit protein eS12 (RPS12) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.005 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Small ubiquitin-related modifier 1 (SUMO1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.007 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| snoRNP protein GAR1 (GAR1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.052 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| snoRNP protein NHP2 (NHP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.059 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| SNW domain-containing protein 1 (SNW1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.014 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| SPATS2-like protein (SPATS2L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.031 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Splicing factor U2AF 35 kDa subunit (U2AF1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.079 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Splicing factor U2AF 65 kDa subunit (U2AF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.031 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| SR-related protein LDC2 (SACM1L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Suppressor of SWI4 1 homolog (PPAN) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.048 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Synaptic functional regulator FMR1 (FMR1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.023 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| TAR DNA binding protein 43 (TARDBP) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.051 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Tat-cotransactivator 2 protein (SUPT6H) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Thyroid hormone receptor-associated protein 3 (THRAP3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.003 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Transcriptional activator protein Pur-beta (PURB) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.022 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Transformer-2 protein homolog alpha (TRA2A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.056 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Transformer-2 protein homolog beta (TRA2B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.025 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Transportin-2 (TNPO2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.072 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Trinucleotide repeat-containing gene 6B protein (TNRC6B) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.039 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| TRMT1-like protein (TRMT1L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.084 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| tRNA methyltransferase 10 homolog C (TRMT10C) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.030 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| tRNA methyltransferase 112 homolog (TRMT112) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.026 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| TTF-1-associated protein 26 (CCDC59) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.093 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| U1 snRNP 70 kDa (SNRNP70) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.025 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| U3 snoRNA-associated protein 11 (ZNF680) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.059 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| U3 snoRNP protein IMP4 (IMP4) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.031 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ubiquitin carboxyl-terminal hydrolase 10 (USP10) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.002 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ubiquitin-associated protein 2 (UBAP2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Ubiquitin-associated protein 2-like (UBAP2L) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.097 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Uncharacterized protein C7orf50 (C7orf50) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.071 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| UPF0696 protein C11orf68 (C11orf68) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Valine--tRNA ligase (VARS) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.011 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| WD repeat-containing protein 50 (UTP18) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| WIBG protein (WIBG) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.022 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| YLP motif-containing protein 1 (YLPM1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.042 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| YTH domain-containing family protein 2 (YTHDF2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.006 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| YTH domain-containing family protein 3 (YTHDF3) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.012 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| YTH domain-containing protein 1 (YTHDC1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.008 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| YTH domain-containing protein 2 (hYTHDC2) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.037 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Zinc finger CCCH domain-containing protein 11A (ZC3H11A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.013 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Zinc finger CCCH domain-containing protein 7A (ZC3H7A) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.056 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Zinc finger CCCH domain-containing protein 8 (ZC3H8) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.022 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Zinc finger CCCH-type antiviral protein 1 (ZC3HAV1) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.100 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Zinc finger protein 622 (ZNF622) | |||||||||
| Protein Details |
Pro Info
Click to show the detail information of this Protein
|
[1] | |||||||
| Infection Time | 24 h | ||||||||
| Infection Cells | Calu-3 cells (Human lung cancer cell) (CVCL_0609 ) | ||||||||
| Cell Originated Tissue | Lung | ||||||||
| Interaction Score | P-adjust = 0.043 | ||||||||
| Description of Detection Method | UV protein-RNA crosslinking; RNA interactome capture (cRIC); RNA antisense purification coupled with mass spectrometry (RAP-MS) | ||||||||
| Virus RNA Sequence Information (Source: GISAID) |
>hCoV-19/England/02/2020|EPI_ISL_407073|2020-01-29
AGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCT
GTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACG
AGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTCGTCC
GGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTT
TTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAA
AGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTT
CGGATGCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTCGTAGT
GGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCTTCTTCGTAAGAACGG
TAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGATCCTT
ATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTGTTACCCGTGAACTCATGCGTGAGCTTAACGGAGGG
GCATACACTCGCTATGTCGATAACAACTTCTGTGGCCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACG
TGCTGGTAAAGCTTCATGCACTTTGTCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAAC
ATGAGCATGAAATTGCTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCA
AAGAAATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAACCAAG
GGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCACCAAATGAATGCAACC
AAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCAGACGGGCGATTTTGTTAAAGCCACT
TGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACTACTTGTGGTTACTTACCCCAAAATGCTGTTGTTAA
AATTTATTGTCCAGCATGTCACAATTCAGAAGTAGGACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGGCTTGA
AAACCATTCTTCGTAAGGGTGGTCGCACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACAAGTGT
GCCTATTGGGTTCCACGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGTCTTAA
TGACAACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGAGATCG
CCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGATTATAAAGCATTCAAA
CAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAGGTGCCTGGAATATTGGTGAACAGAA
ATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCGTGTTGTACGATCAATTTTCTCCCGCACTCTTGAAA
CTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCCGCTATAACAATACTAGATGGAATTTCACAGTATTCACTGAGACTC
ATTGATGCTATGATGTTCACATCTGATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTTGTTCA
GTTGACTTCGCAGTGGCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGAAGAGA
AGTTTAAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAATTGTC
GGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGTAAATAAATTTTTGGC
TTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTAGGTGAAACATTTGTCACGCACTCAA
AGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCCTACTCATGCCTCTAAAAGCCCCAAAAGAAATTATC
TTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTTAACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCATTAGA
ACAACCTACTAGTGAAGCTGTTGAAGCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGAAATCA
AAGACACAGAAAAGTACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTGCACCA
ACAAAGGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTTGATGA
AAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAAATGAGTTCGCCTGTG
TTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACCACTGGGCATTGATTTAGATGAGTGG
AGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAATTGGCTTCACATATGTATTGTTCTTTCTACCCTCC
AGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAGAAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGAAGATG
ATTACCAAGGTAAACCTTTGGAATTTGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTA
GATGATGATAGTCAACAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTTGA
GGTTCAACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTTAAAAC
TTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAACCAACAGTGGTTGTTAATGCA
GCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTACTAACAATGCCATGCAAGTTGAATC
TGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAGTTGTGTTTTAAGCGGACACAATCTTGCTAAACACT
GTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGTGAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAATCAG
CACGAAGTTCTACTTGCACCATTATTATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGTGTAGA
TACTGTTCGCACAAATGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGAAATGA
AGAGTGAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTAAACCT
TCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAACTCTGGAAGAAACTAA
GTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCAGATTCTGCCACTCTTGTTAGTGACA
TTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTGATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTT
ATACCTACTAAAAAGGCTGGTGGCACTACTGAAATGCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAAC
CACTTACCCGGGTCAGGGTTTAAATGGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCCTTTT
ACATTCTACCATCTATTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGCTTGCA
CATGCAGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAATATAA
GGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAACAACTGTAGCGTCAC
TTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTATGTAACACATGGCTTAAATTTGGAA
GAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTTTCTGTTTCTTCACCTGATGCTGTTACAGCGTATAA
TGGTTATCTTACTTCTTCTTCTAAAACACCTGAAGAACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAAAGATT
GGTCCTATTCTGGACAATCTACACAACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTAGTAAT
CCTACCACATTCCACCTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTGAGGAC
TATTAAGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACAACAGT
TTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGTAAAACATTTTATGTT
TTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTGATCCTAGTTTTCTGGGTAGGTACAT
GTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAACAACT
GTTATCTTGCCACTGCATTGTTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTAC
AGAGCAAGGGCTGGTGAAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGA
TGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTGTAAAA
CTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAATTTAAG
AAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTCACCTTTTGTTATGAT
GTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGTGAGTACACTGGTAATTACCAGTGTG
GTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAGACGGTGCTTTACTTACAAAGTCCTCAGAATACAAA
GGTCCTATTACGGATGTTTTCTACAAAGAAAACAGTTACACAACAACCATAAAACCAGTTACTTATAAATTGGATGGTGT
TGTTTGTACAGAAATTGACCCTAAGTTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAATTGATC
TTGTACCAAACCAACCATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTGATGAT
TTAAACCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGTGATGT
GGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAACCTATTGTTTGGCATG
TTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTGTCTTTGGAGCACAAAACCAGTTGAA
ACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGAATGGATAATCTTGCCTGCGAAGATCTAAAACCAGT
CTCTGAAGAAGTAGTGGAAAATCCTACCATACAGAAAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAG
ACATTATACTTAAACCAGCAAATAATAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTA
GACAATTCTAGTCTTACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCATGGTTT
AGCTGCTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTACAACTA
CTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTATTGCTACAATTGTGT
ACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAGCAAAGAATACTGTTAAGAGTGTCGG
TAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAATTTTTCTAAACTGATAAATATTATAATTTGGTTTT
TACTATTAAGTGTTTGCCTAGGTTCTTTAATCTACTCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCT
TCTTACTGTACTGGTTACAGAGAAGGCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACC
TTGTAGTGTTTGTCTTAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTCATCTT
TTAAATGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCTATGTA
CTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTCTTGGCTTATGTGGTT
AATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATCTTCTTTGCATCATTTTATTATGTAT
GGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTTGTATGATGTGTTACAAACGTAATAGAGCAACAAGA
GTCGAATGTACAACTATTGTTAATGGTGTTAGAAGGTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAAACT
ACACAATTGGAATTGTGTTAATTGTGATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGT
CACTACAGTTTAAAAGACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATGGTTCC
ATCCATCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGACAACCT
GAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAATGTGAAGAATCATCTG
CAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACTAGATCAGGCATTAGTGTCTGATGTT
GGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTTAATACGTTTTCATCAACTTTTAACGTACCAATGGA
AAAACTCAAAACACTAGTTGCAACTGCAGAAGCTGAACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTTA
TTTCAGCAGCTCGGCAAGGGTTTGTTGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACATCAA
TCTGACATAGAAGTTACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCCCGTGA
CCTTGGTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGATATGGA
ACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAGAATAACTTACCTTTT
AAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAGCACTTAAGGGTGGTAAAATTGTTAA
TAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTTTGTTGCTGCTATTTTCTATTTAATAACACCTGTTC
ATGTCATGTCTAAACATACTGACTTTTCAAGTGAAATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACATA
GCATCTACAGATACTTGTTTTGCTAACAAACATGCTGATTTTGACACATGGTTTAGTCAGCGTGGTGGTAGTTATACTAA
TGACAAAGCTTGCCCATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCACGATAT
TACGCACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACACCATCA
AAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTTTAAAGATGCTTCTGG
TAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTATGAAAGTTTACGCCCTGACACACGTT
ATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACCTTGAAGGTTCTGTTAGAGTGGTAACAACTTTTGAT
TCTGAGTACTGTAGGCACGGCACTTGTGAAAGATCAGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTACTTAA
CAATGATTATTACAGATCTTTACCAGGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTACACCAC
TAATTCAACCTATTGGTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACATGCCTT
GCCTACTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTCCTTAT
GTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTTACTTGTACTTGACAT
TTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTTCACACCTTTAGTACCTTTCTGGATA
ACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGGTTCTTTAGTAATTACCTAAAGAGACGTGTAGTCTT
TAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTGCGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAAGTTGC
GTAGTGATGTGCTATTACCTCTTACGCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCA
ATGGATACAACTAGCTACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGTTCTGA
TGTTCTTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCCATCTG
GTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTTGATGACGTAGTTTAC
TGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAGATTTACTCATTCGTAAGTCTAATCA
TAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGGACATTCTATGCAAAATTGTGTACTTAAGCTTAAGG
TTGATACAGCCAATCCTAAGACACCTAAGTATAAGTTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAGCTTGT
TACAATGGTTCACCATCTGGTGTTTACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAATGGTTC
ATGTGGTAGTGTTGGTTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAACTGGAG
TTCATGCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTACGGAC
ACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTTTCTCAATCGATTTAC
CACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTAACACAAGACCATGTTGACATACTAG
GACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTGCTTCATTAAAAGAATTACTGCAAAATGGTATGAAT
GGACGTACCATATTGGGTAGTGCTTTATTAGAAGATGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGTGTTAC
TTTCCAAAGTGCAGTGAAAAGAACAATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAGTTT
TAGTCCAGAGTACTCAATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTATTGCT
ATGTCTGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCCACTGT
AGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATATGGTTGATACTAGTT
TGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACTAATCCTTATGACAGCAAGAACTGTG
TATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTGACACTCGTTTATAAAGTTTATTATGGTAATGCTTT
AGATCAAGCCATTTCCATGTGGGCTCTTATAATCTCTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCATGTTTT
TGGCCAGAGGTATTGTTTTTATGTGTGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTATAATG
CTAGTTTATTGTTTCTTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGACTGAC
TCTTGGTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAAGAATA
GCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTAGCCACTGTACAGTCT
AAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAACTCAGAGTAGAATCATCATCTAAATT
GTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAAAGATACTACTGAAGCCTTTGAAAAAATGGTTTCAC
TACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTAGACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGGCAACC
TTACAAGCTATAGCCTCAGAGTTTAGTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAGCAGGC
TGTTGCTAATGGTGATTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGACCGTG
ATGCAGCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTGAGGAC
AAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAATGATGCACTCAACAA
CATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACAACAGCAGCCAAACTAATGGTTGTCA
TACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACATTTACTTATGCATCAGCATTGTGGGAAATCCAACAG
GTTGTAGATGCAGATAGTAAAATTGTTCAACTTAGTGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCTCTTAT
TGTAACAGCTTTAAGGGCCAATTCTGCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTT
GTGCTGCCGGTACTACACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTAGGTTT
GTACTTGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATCTATAC
AGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTATACTTTATTAAAGGAT
TAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCTACAAGCTGGTAATGCAACAGAAGTG
CCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGATGCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGG
GGGACAACCAATCACTAATTGTGTTAAGATGTTGTGTACACACACTGGTACTGGTCAGGCAATAACAGTTACACCGGAAG
CCAATATGGATCAAGAATCCTTTGGTGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAA
GGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAA
CACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAG
CTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCACTAGTACTG
ATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAAATTCCTAAAAACTAATTGTTGTCGC
TTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAACA
TGAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTG
ACATGGTACCACATATATCACGTCAACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGAT
GAAGGTAATTGTGACACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAGGACTG
GTATGATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTTAAAAA
CAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAAGATCTCAATGGTAAC
TGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTGTAGATTCTTATTATTCATTGTTAAT
GCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGTTGACACTGACTTAACAAAGCCTTACATTAAGTGGG
ATTTGTTAAAATATGACTTCACGGAAGAGAGGTTAAAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCAC
CCAAATTGTGTTAACTGTTTGGATGACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCCC
ACCTACAAGTTTTGGACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCACTTCA
GAGAGCTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGTATGCT
GCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTCAGTAGCTGCACTTAC
TAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTATGACTTTGCTGTGTCTAAGGGTTTCT
TTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTCAGGATGGTAATGCTGCTATCAGCGATTATGACTAC
TATCGTTATAATCTACCAACAATGTGTGATATCAGACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTG
TTACGATGGTGGCTGTATTAATGCTAACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAAT
GGGGTAAGGCTAGACTTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTAATGTC
ATCCCTACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTCTCTAT
CTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAGGAGCTACTGTAGTAA
TTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTAGAAAACCCTCACCTTATG
GGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAATTATGGCCTCACTTGTTCTTGCTCGCAAACA
TACAACGTGTTGTAGCTTGTCACACCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGT
GTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAAC
ATTTGTCAAGCTGTCACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGCAA
TTTACAACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGCATATT
TGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTATGCATCTCAAGGTCTA
GTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTATGTCTGAAGCAAAATGTTGGACTGA
GACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATACAATGCTAGTTAAACAGGGTGATGATTATGTGTACC
TTCCTTACCCAGATCCATCAAGAATCCTAGGGGCCGGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATG
ATTGAACGGTTCGTGTCTTTAGCTATAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTCA
TTTGTACTTACAATACATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCTTACTA
ATGATAACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTGTTGGG
GCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTTATGTTGTAAATGCTG
TTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTATGTTTGCAATGCTCCAGGTTGTGATG
TCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATTGTAAATCACATAAACCACCCATTAGTTTTCCATTG
TGTGCTAATGGACAAGTTTTTGGTTTATATAAAAATACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCAATTGC
AACATGTGACTGGACAAATGCTGGTGATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGCAGAAA
CGCTCAAAGCTACTGAGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAGAATTA
CATCTTTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACTAAAAA
CAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACCGAGGTACAACAACTT
ACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATTAAGTGCACCTACACTAGTGCCACAA
GAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATCTCAGATGAGTTTTCTAGCAATGTTGCAAATTATCA
AAAGGTTGGTATGCAAAAGTATTCTACACTCCAGGGACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCTAGCTC
TCTACTACCCTTCTGCTCGCATAGTGTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCATTAAAA
TATTTGCCTATAGATAAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTGAATTC
AACATTAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGAAATTT
CAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTACATTGGCGACCCTGCT
CAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAA
AACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTT
ATGATAATAAGCTTAAAGCACATAAAGACAAATCAGCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGCATGAT
GTTTCATCTGCAATTAACAGGCCACAAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAAGCTGT
CTTTATTTCACCTTATAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTCATCAC
AGGGCTCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTAATGTT
GCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTTGCAATTTACAAGTCT
TGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTCTTTAAAGATTGTAGTAAGGTAATCA
CTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACACTAAATTCAAAACTGAAGGTTTATGTGTTGACATA
CCTGGCATACCTAAGGACATGACCTATAGAAGACTCATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTA
CCCTAACATGTTTATCACCCGCGAAGAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTGTCATG
CTACTAGAGAAGCTGTTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTACCTACA
GGTTATGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAACACCT
CACACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAAGTGACACACTTAAAA
ATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATCTATGAAGTATTTTGTGAAAATAGGA
CCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTTTCCACTGCTTCAGACACTTATGCCTGTTGGCATCA
TTCTATTGGATTTGATTACGTCTATAATCCGTTTATGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCA
ACCATGATCTGTATTGTCAAGTCCATGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTC
CACGAGTGCTTTGTTAAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCGGCTTG
TAGAAAGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAACCCTA
AAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGTGACAAAGCTTATAAA
ATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTGTATGCCTATTTTGGAATTGCAATGT
CGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAGAGTGCTATCTAACCTTAACTTGCCTGGTTGTGATG
GTGGCAGTTTGTATGTAAATAAACATGCATTCCACACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAACAATTA
CCATTTTTCTATTACTCTGACAGTCCATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCACTAAA
GTCTGCTACGTGTATAACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTATCTCG
ATGCTTATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGAACACT
TTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGGACAACAGGGTGAAGT
ACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTAGAATTGTTTGAAAATAAAACAACAT
TACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTAAACCAGTACCAGAGGTGAAAATACTCAATAATTTG
GGTGTGGACATTGCTGCTAATACTGTGATCTGGGACTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGTGTTTG
TTCTATGACTGACATAGCCAAGAAACCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGTTGATG
GTCAAGTAGACTTATTTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCATCTGTA
GGTCCCAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAGAAAGT
TGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTAAACCCAGGAGTCAAA
TGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATTAGAAGGCTATGCCTTCGAACATATC
GTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTACTGATTGGACTAGCTAAACGTTTTAAGGAATCACC
TTTTGAATTAGAAGATTTTATTCCTATGGACAGTACAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTCATCTA
AGTGTGTGTGTTCTGTTATTGATTTATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAGTTTCT
AAGGTTGTCAAAGTGACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACATTTTA
CCCAAAATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCTATTAG
AAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTCGCAAAATATACTCAA
CTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTATACATTTTGGTGCTGGTTCTGATAA
AGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTACGGGTACGCTGCTTGTCGATTCAGATCTTAATGACT
TTGTCTCTGATGCAGATTCAACTTTGATTGGTGATTGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTATTAGT
GATATGTACGACCCTAAGACTAAAAATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGTGGGTT
TATACAACAAAAGCTAGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGC
TCATGGGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTGGATGT
AATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTGGAGGAATACAAATCC
AATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAA
AAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAGAGAAAACAACAGAGTTGTT
ATTTCTAGTGATGTTCTTGTTAACAACTAAACGAACAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGT
GTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAA
GTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTAT
ACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCA
CTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAAT
AACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAA
CAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTT
TTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTT
AAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGA
TTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTT
CTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAA
AATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCACTGT
AGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAACT
TGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTATGCTTGGAACAGGAAGAGAATCAGCAACTGT
GTTGCTGATTATTCTGTCCTATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAA
TGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAA
CTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTT
GATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATAT
TTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCAT
ATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCA
GCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGG
CACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATG
CTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGA
ACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCA
ACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAAC
ATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCCG
CGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTC
TAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCTATGACCAAGACAT
CAGTAGATTGTACAATGTACATTTGTGGTGATTCAACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACA
CAATTAAACCGTGCTTTAACTGGAATAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAAT
TTACAAAACACCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGA
GGTCATTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATTGCCTT
GGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACCTTTGCTCACAGATGA
AATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGGACCTTTGGTGCAGGTGCTGCATTAC
AAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTGGAGTTACACAGAATGTTCTCTATGAGAACCAAAAA
TTGATTGCCAACCAATTTAATAGTGCTATTGGCAAAATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACT
TCAAGATGTGGTCAACCAAAATGCACAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAA
GTGTTTTAAATGATATCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTT
CAAAGTTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCTACTAA
AATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTATGTCCTTCCCTCAGT
CAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAAGAACTTCACAACTGCTCCTGCCATT
TGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTTTCAAATGGCACACACTGGTTTGTAACACAAAGGAA
TTTTTATGAACCACAAATCATTACTACAGACAACACATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACA
ACACAGTTTATGATCCTTTGCAACCTGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCA
CCAGATGTTGATTTAGGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGA
GGTTGCCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCCATGGT
ACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGTATGACCAGTTGCTGT
AGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACGACTCTGAGCCAGTGCTCAAAGGAGT
CAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGAATCTTCACAATTGGAACTGTAACTTTGAAGCAAGG
TGAAATCAAGGATGCTACTCCTTCAGATTTTGTTCGCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTTCGGAT
GGCTTATTGTTGGCGTTGCACTTCTTGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGCAACTA
GCACTCTCCAAGGGTGTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTCGTTGC
TGCTGGCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAATAATAA
TGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTTCTTTGCTGGCATACT
AATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTACTTCAGGTGATGGCACAACAAGTCC
TATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATGGGAATCTGGAGTAAAAGACTGTGTTGTATTACACA
GTTACTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCTTCTTC
ATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCC
AGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTA
TGTACTCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTG
CTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTCTTGTAAAACC
TTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGATCTTCTGGTCTAAACGAACTAAATAT
TATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGATTCCAACGGTACTATTACCGTTGAAGAGCTTAAAA
AGCTCCTTGAACAATGGAACCTAGTAATAGGTTTCCTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATGCCAAC
AGGAATAGGTTTTTGTATATAATTAAGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTGCTTGC
TGCTGTTTACAGAATAAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCTCAGCT
ACTTCATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTCTCAAC
GTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGTGATCCTTCGTGGACA
TCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAAGAAATCACTGTTGCTACATCACGAA
CGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTGACTCAGGTTTTGCTGCATACAGTCGCTACAGGATT
GGCAACTATAAATTAAACACAGACCATTCCAGTAGCAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACAGATGT
TTCATCTCGTTGACTTTCAGGTTACTATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTTGGAAT
CTTGATTACATCATAAACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGATGAAGA
GCAACCAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGAGCTTT
ATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACATACGAGGGCAATTCA
CCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAATTTGCTTTTGCTTGTCCTGACGGCGT
AAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACTGTTCATCAGACAAGAGGAAGTTCAAGAACTTTACT
CTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTTATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGATTGAAC
TTTCATTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTTGGTTC
TCACTTGAACTGCAAGATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATCATCAC
AACTGTAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCCGTGTC
CTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAATTGTGCGTGGATGAG
GCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCTGTTCACCTTTTACAATTAATTGCCA
GGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGAAGACTTTTTAGAGTATCATGACGTTCGTGTTGTTT
TAGATTTCATCTAAACGAACAAACTAAAATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTG
GTGGACCCTCAGATTCAACTGGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGT
TTACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGG
CGTTCCAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTG
ACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGGT
GCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATCC
TGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAG
GCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGA
ACTTCTCCTGCTAGAATGGCTGGCAATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGA
GAGCAAAATGTCTGGTAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGC
CTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCCAAGGA
AATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGC
TTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTGACCTACACAGGTGCCATCA
AATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGCTGAATAAGCATATTGACGCATACAAAACATTCCCA
CCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGCTGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAAC
TGTGACTCTTCTTCCTGCTGCAGATTTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTC
AGGCCTAAACTCATGCAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATGTATAGTCTA
CTCTTGTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCTTTAAT
CAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTACGATCGAGTGTACAGT
GAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCATGTG
Click to Show/Hide
|
|---|
| References | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | Global analysis of protein-RNA interactions in SARS-CoV-2-infected cells reveals key regulators of infection. Mol Cell. 2021 Jul 1;81(13):2851-2867.e7. | ||||||||||||||||||

