Virus RNA General Information
Strain Information		Strain Name		hCoV-19/Not Specified Virus Strain
		RNA Binding Site		ORF10
Virus Information		Virus Name		Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
		Taxonomy ID		2697049
		GeneBank ID		MN996528.1

Virus RNA - Host Protein Network
Regulation Network
		Network Download

Full list of proteins interacting with the ORF10 of this Strain
hnRNP A1 messenger RNA (HNRNPA1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
IGF2-binding protein 1 (IMP-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Eukaryotic initiation factor 4A-I (EIF4A1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
APOBEC1-binding protein 1 (HNRNPAB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Elongation factor Tu, mitochondrial (TUFM)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
hnRNP A2/B1 messenger RNA (HNRNPA2B1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Lipopolysaccharide-associated protein 1 (HSPA8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Tubulin beta chain (MRPS18B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Nucleolin (NCL)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
130 kDa leucine-rich protein (LRP 130)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
14-3-3 protein epsilon (14-3-3E)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
14-3-3 protein zeta/delta (KCIP-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
2'-5'-oligoadenylate synthase 3 (2-5A synthase 3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S15 (MRP-S15)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S16 (MRP-S16)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S17 (MRP-S17)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S2 (S2mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S22 (S22mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S23 (MRP-S23)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S25 (S25mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S26 (MRP-S26)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S27 (S27mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S28 (MRP-S28)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S29 (MRP-S29
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S34 (S34mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S5 (S5mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S7 (MRP-S7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
28S ribosomal protein S9 (S9mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
39S ribosomal protein L11 (L11mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
39S ribosomal protein L15 (L15mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
39S ribosomal protein L23 (L23mt)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
39S ribosomal protein L28 (MRP-L28)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
39S ribosomal protein L4 (MRP-L4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
39S ribosomal protein L41 (MRP-L41)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
39S ribosomal protein L47 (MRP-L47)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S11 (RPS10)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S16 (RPS15A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S17 (RPS16)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S19 (TUBB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S2 (RPS19)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S20 (RPS2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S24 (RPS20)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S26 (RPS25)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S3a (RPS3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S4, X isoform (RPS3A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S5 (RPS4X)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S6 (RPS5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S8 (RPS7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
40S ribosomal protein S9 (RPS8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
5'-3' exoribonuclease 1 (ACACA)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L10a (RPLP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L11 (RPL10A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L12 (RPL11)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L13 (RPL12)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L13a (RPL13)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L14 (RPL13A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L17 (RPL14)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L18a (RPL18)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L19 (RPL18A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L21 (RPL19)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L22 (RPL21)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L24 (RPL23)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L26 (RPL24)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L28 (RPL27)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L30 (RPL3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L31 (RPL30)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L35 (RPL34)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L36 (RPL35A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L36a-like (RPL36)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L5 (RPL4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L6 (RPL5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L7 (RPL6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L7a (RPL7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L9 (RPL8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
60S ribosomal protein L9 (RPL9)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
7SK snRNA methylphosphate capping enzyme (MePCE)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Activator of 90 kDa heat shock protein ATPase homolog 1 (AHA1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Acyl-CoA thioesterase 9 (CGI-16)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Acyl-coenzyme A diphosphatase FITM2 (FIT2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Adaptor protein complex AP-3 subunit beta-1 (ADTB3A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Adenylyl cyclase-associated protein 1 (CAP 1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Aldehyde dehydrogenase 1A1 (ALHDII)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
AS1 14-3-3 protein eta (YWHAH)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
ASF/SF2-associated protein p32 (C1QBP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Aspartate beta-hydroxylase (ASPH)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Aspartate--tRNA ligase (DARS)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
ATP synthase subunit gamma (ATP5C)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
ATP-binding cassette 50 (ABC50)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
ATP-dependent RNA helicase A (DHX9)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Bcl-2-associated transcription factor 1 (Btf)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Bcl-XL-binding protein v68 (PRKDC)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
BTB/POZ domain-containing protein (KCTD14)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Cap methyltransferase 1 (MTr1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
CDKN2AIP N-terminal-like protein (CDKN2AIPNL)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Cell cycle and apoptosis regulatory protein 1 (CARP-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Cell division cycle 5-like protein (Cdc5-like protein)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Cleavage factor Im complex 59 kDa subunit (CFIm59)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Cleavage stimulation factor 64 kDa subunit (CstF-64)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
COP9 signalosome complex subunit 4 (COPS4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
CPE-binding protein 2 (hCPEB-2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
CPSF 100 kDa subunit (CPSF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
CPSF 73 kDa subunit (CPSF73)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
CUGBP Elav-like family member 1 (CELF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Cyclin-K (CCNK)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Cysteines of Keap1 (KEAP1 Cysteines)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Cytoplasmic FMR1-interacting protein 1 (NOL12)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Cytoskeleton-associated protein 4 (CKAP4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
D-fructose-6-phosphate amidotransferase 1 (GFPT1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DBIRD complex subunit ZNF326 (ZNF326)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DDOST 48 kDa subunit (APOBEC3C)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DEAD box protein 47 (PHB2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DEAD box protein 50 (DDX50)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DEAD box protein 54 (DDX54)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DEAD box protein 56 (DDX56)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DEAD box protein 6 (DDX6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DEAD box protein 60 (DDX60)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DEK protein (DEK)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DiGeorge syndrome critical region 8 (DGCR8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Dimethyladenosine transferase 1 (TFB1M)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DNA damage-binding protein 1 (DDB1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DNA repair protein XRCC6 (XRCC6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DNA replication licensing factor MCM5 (MCM5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DNA replication licensing factor MCM7 (MCM7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DNA topoisomerase II alpha (TOP2A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DNA-directed RNA polymerase (POLRMT)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DNA-directed RNA polymerase II subunit E (POLR2E)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DnaJ homolog subfamily B member 11 (DNAJB11)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DnaJ homolog subfamily C member 10 (DNAJC10)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Double-stranded RNA-binding protein Staufen homolog 2 (STAU2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
DRG family-regulatory protein 1 (ZC3H15)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Dynein light chain 1, cytoplasmic (DYNLL1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
E3 ubiquitin-protein ligase DZIP3 (DZIP3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Echinoderm microtubule-associated protein-like 4 (EMAP-4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
eIF-2-alpha (EIF2S1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
eIF-2-beta (EIF2S2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
eIF-2-gamma X (EIF2S3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
eIF-3-eta (EIF3B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
eIF-3-theta (EIF3A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Elongation factor 1-gamma (RBM15B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Elongation factor 2 (EEF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Endoplasmin (HSP90B1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Enhancer of rudimentary homolog (ERH)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Epithelial splicing regulatory protein 1 (ESRP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Eukaryotic initiation factor 4A-III (EIF4A3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Eukaryotic translation initiation factor 3 subunit C (EIF3C)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Eukaryotic translation initiation factor 3 subunit D (EIF3D)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Eukaryotic translation initiation factor 3 subunit E (EIF3E)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Eukaryotic translation initiation factor 3 subunit F (EIF3F)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Eukaryotic translation initiation factor 3 subunit G (EIF3G)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Eukaryotic translation initiation factor 3 subunit H (EIF3H)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Eukaryotic translation initiation factor 3 subunit L (EIF3L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Eukaryotic translation initiation factor 6 (DDOST)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Exosome complex component MTR3 (PRRC2A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Exosome complex component RRP41 (EXOSC4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Exosome complex component RRP45 (EXOSC9)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Exosome component 10 (POLR2A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Far upstream element-binding protein 1 (FUBP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Fat-inducing protein 1 (BBOX1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Fructose-bisphosphate aldolase A (ALDOA)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
G patch domain-containing protein 2 (GPATCH2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
G patch domain-containing protein 4 (GPATCH4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
G patch domain-containing protein 6 (ZGPAT)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
G patch domain-containing protein 8 (GPATCH8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Gamma-interferon-inducible protein 16 (IFI16)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
GARS (GARS)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
GDNF-inducible zinc finger protein 1 (GZF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Gem-associated protein 5 (GEMIN5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Glutamate--tRNA ligase (EPRS)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Glutamate-rich WD repeat-containing protein 1 (GRWD1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Glutamine amidotransferase (GMPS)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Glycoprotein p43 (RBMX)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Growth factor receptor-bound protein 7 (GRB7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
GTP-binding protein 1 (DRG-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Guanine nucleotide binding protein beta polypeptide 2-like 1 (SARNP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Heat shock 70 kDa protein 1B (HSPA1B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Heat shock protein 75 kDa (TRAP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Heat shock protein 90 alpha (HSP90A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Heat shock protein 90 beta (HSP90B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Helicase A-binding protein 95 (HAP95)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Helicase-moi messenger RNA (DICER1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Herpesvirus ubiquitin-specific protease (HAUSP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Heterogeneous nuclear ribonucleoprotein L-like (HNRNPLL)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Heterogeneous nuclear ribonucleoprotein R (RUVBL1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Histone H2A type 1-J (TMEM200C)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
hnRNP C-like-2 (HNRNPCP5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Host cell factor 1 (HCFC1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
IF-4-gamma 1 (EIF4G1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
IGF2-binding protein 2 (IMP-2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
IGF2-binding protein 3 (IMP-3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Importin beta (KPNB1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Inosine 5'-monophosphate cyclohydrolase (IMP cyclohydrolase)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Interleukin enhancer-binding factor 2 (ILF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Kinesin-like protein KIF2A (KIF2A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Kinesin-like protein KIFC1 (ADSL)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
L-lactate dehydrogenase B chain (LDHB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
La-related protein 7 (LARP7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Laminin beta-3 chain (LAMB3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Laminin gamma-2 subunit (LAMC2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Laminin receptor 37/67kDa (LRP/LR)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Large ribosomal subunit protein eL15 (RPL15)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Leucine-rich repeat-containing protein 59 (LRRC59)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Leukocyte receptor cluster member 9 (DDX24)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
LINE retrotransposable element 1 (L1ORF1p)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Lysyl hydroxylase 1 (PLOD1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Metastasis adhesion protein (MTDH)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Metastasis-associated protein MTA2 (MTA2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Microtubule-associated protein 4 (MAP4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Mitochondrial citrate transporter (SLC25A1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Mitochondrial matrix protein P1 (HSPD1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Mortalin (HSPA9)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Mothers against decapentaplegic homolog 3 (SMAD3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
N-acylneuraminate cytidylyltransferase (CMAS)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
NF-kappa-B-repressing factor (NKRF)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Nicotinamide phosphoribosyltransferase (NAMPT)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Novel nuclear protein 1 (RRP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
NS1 effector domain-binding protein 1 (Neb-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Nuclear cap-binding protein subunit 1 (NCBP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Nuclear cap-binding protein subunit 2 (NCBP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Nuclear export mediator factor (NEMF)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Nuclear factor 1 B-type (NFIB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Nucleolar protein 56 (NOP56)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Nucleolar transcription factor 1 (UBTF)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Nucleolysin TIAR (TIAL1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
P120 messenger RNA (NOP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Periodic tryptophan protein 1 homolog (PWP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Pescadillo homolog (PES1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Phenylalanine--tRNA ligase beta subunit (FARSB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Phosphate carrier protein, mitochondrial (SLC25A3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Phosphatidylinositol-binding clathrin assembly protein (CALM)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
PIN2/TERF1-interacting telomerase inhibitor 1 (PINX1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Plakophilin-3 (PKP3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Pleiotropic regulator 1 (PLRG1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Poly(rC)-binding protein 1
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Polymerase delta-interacting protein 3 (POLDIP3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Pre-mRNA 3'-end-processing factor FIP1 (FIP1L1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Pre-mRNA cleavage complex II protein Pcf11 (PCF11)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Pre-mRNA-processing factor 31 (hPrp31)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Pre-mRNA-splicing factor SYF1 (XAB2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Probable rRNA-processing protein EBP2 (EBNA1BP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Profilin-1 (PFN1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Programmed cell death protein 8 (PDCD8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Proliferating cell nuclear antigen (PCNA)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Prolyl 4-hydroxylasesubunit alpha-1 (P4HA1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Protein arginine methyltransferase 1 (PRMT1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Protein arginine methyltransferase 5 (PRMT5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Protein bicaudal C homolog 1 (BICC1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Protein disulfide-isomerase A3 (PDIA3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Protein FAM98A (FAM98A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Protein kinase C inhibitor protein 1 (KCIP-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Protein kinase C inhibitor protein 1 (KCIP-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Protein lin-28 homolog B (LIN28B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Protein LSM14 homolog B (LSM14B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Protein SCAF11 (SCAF11)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Putative ATP-dependent RNA helicase DHX57 (DHX57)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Putative methyltransferase C9orf114 (SHROOM4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Putative RNA-binding protein 15B (BOP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Ras GTPase-activating-like protein IQGAP1 (IQGAP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Regulator of nonsense transcripts 1 (NORF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Replication factor C subunit 1 (RFC1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Replication factor C subunit 2 (RFC2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Replication factor C subunit 4 (RFC4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Ribonuclease inhibitor (RNH1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Ribonuclease P protein subunit p20 (POP7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Ribonucloprotein (NHP2L1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Ribophorin I (RPN-I)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Ribosomal protein S6 kinase alpha-3 (RSK3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Ribosome biogenesis protein BOP1 (RBM8A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Ribosome biogenesis regulatory protein homolog (RRS1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Ribosome production factor 2 homolog (RPF2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Ribosome-binding protein 1 (RRBP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RIG-I-like receptor 3 (RLR-3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA 3'-terminal phosphate cyclase-like protein (RCL1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA binding protein fox-1 homolog 2 (RPS17)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA helicase aquarius (AQR)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA polymerase I-associated factor 1 (POLR1E)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA-binding protein 14 (IGKV1-33)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA-binding protein 15 (RBM15)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA-binding protein 27 (RBM27)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA-binding protein 28 (RBM28)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA-binding protein 42 (RBM42)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA-binding protein 5 (G15)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA-binding protein FUS (FUS)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RNA-splicing ligase RtcB homolog (RTCB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RRP1-like protein B (RRP1B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RuvB-like 1 (EIF5A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
RuvB-like 2 (RUVBL2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
S1 RNA-binding domain-containing protein 1 (SRBD1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
SAM domain-containing protein 9 (SERPINB4)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Serine/arginine-rich splicing factor 1 (SRSF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Serine/arginine-rich splicing factor 10 (SRSF10)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Serine/arginine-rich splicing factor 11 (SRSF11)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Serine/arginine-rich splicing factor 3 (SRSF3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Serine/arginine-rich splicing factor 7 (SRSF7)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Signal recognition particle 9 kDa protein (SRP9)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Signal recognition particle subunit SRP68 (SRP68)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Signal recognition particle subunit SRP72 (SRP72)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
SKIV2L2 protein (SKIV2L2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Small nuclear ribonucleoprotein E (SNRPE)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Small nuclear ribonucleoprotein G (SNRPG)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Small ribosomal subunit protein eS12 (RPS12)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Solute carrier family 25 member 11 (SLC25A11)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Solute carrier family 25 member 13 (Citrin)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Sphingosine-1-phosphate lyase 1 (SGPL1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Spliceosome-associated protein 155 (SF3B1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Splicing factor 1 (SF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Splicing factor 3A subunit 1 (SF3A1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Splicing factor 3A subunit 2 (SF3A2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Splicing factor 3A subunit 3 (SF3A3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Splicing factor 3B subunit 3 (SF3B3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Splicing factor 3B subunit 5 (SF3B5)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Splicing factor 3B subunit 6 (SF3B6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Splicing factor 3B-associated 14 kDa protein (SF3b14b)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Splicing factor 45 (RBM17)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Splicing factor Prp43 (hPrp43)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
SR-related CTD-associated factor 6 (SCAF6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
SRSF protein kinase 1 (SRPK1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Succinyl-CoA synthetase beta-A chain (SUCLA2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Succinyl-CoA synthetase beta-G chain (SCS-betaG)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Sulfide:quinone oxidoreductase (TXNDC9)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
SURP and G-patch domain-containing protein 1 (SUGP1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
SURP and G-patch domain-containing protein 2 (SUGP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
T-cell-restricted intracellular antigen-1 (TIA-1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
TAR RNA-binding protein 2 (TARBP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
TAR RNA-interacting protein (TRIP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Target of EGR1 protein 1 (TOE1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Thioredoxin-dependent peroxide reductase (PRDX3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Thyroid hormone receptor-associated protein 3 (THRAP3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Tight junction protein ZO-2 (TJP2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Torsin-4A (TOR4A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Trans-2,3-enoyl-CoA reductase (TER)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Transcription factor IIIC subunit alpha (GTF3C1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Transcription factor IIIC subunit beta (GTF3C2)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Transcription factor IIIC subunit gamma (GTF3C3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Transcription factor MafF (MAFF)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Transcription intermediary factor 1-beta (TRIM28)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Transcriptional activator protein Pur-alpha (PURA)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Transcriptional activator protein Pur-beta (PURB)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Transcriptional repressor p66-beta (RPL17)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Transformation-related gene 15 protein (TRG-15)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Treacle protein (TCOF1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Triosephosphate isomerase (TPI1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Triple homeobox protein 1 (TIX1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
TRMT1-like protein (TRMT1L)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
tRNA pseudouridine synthase-like 1 (PUSL1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
tRNA(m1A58)MTase subunit (TRMT61A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
tRNA(m1A58)MTase subunit TRM6
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Tubulin alpha-1B chain (TUBA1B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Tubulin beta-4B chain (TUBB4B)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Tudor-interacting repair regulator protein (NUDT16L1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Tuftelin-interacting protein 11 (TFIP11)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Tyrosine-protein kinase ABL1 (ABL)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
U4/U6.U5 tri-snRNP-associated protein 1 (SART1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
U8 snoRNA-decapping enzyme (NUDT16)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
UDP-glucose pyrophosphorylase (UDPGP)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Uncharacterized protein KIAA1522 (KIAA1522)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Unconventional myosin-Ic (MYO1C)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Unconventional myosin-Id (MYO1D)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Unconventional myosin-VI (MYO6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Vesicle-fusing ATPase (NSF)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
WD repeat-containing protein 33 (WDR33)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
WD repeat-containing protein 6 (WDR6)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Y-box-binding protein 1 (YBX1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Y-box-binding protein 2 (SHFL )
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Y-box-binding protein 3 (YBX3)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Zinc finger CCCH domain-containing protein 11A (ZC3H11A)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Calu-3 cells (Human Lung Cancer Cell)  (CVCL_0609 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Zinc finger CCCH domain-containing protein 8 (ZC3H8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Zinc finger CCCH-type antiviral protein 1 (ZC3HAV1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Zinc finger CCHC domain-containing protein 8 (ZCCHC8)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Zinc finger protein 346 (ZNF346)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Zinc finger protein 629 (L1RE1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Zinc finger protein 768 (ZNF768)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Zinc finger RNA-binding protein (ZFR)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)
Zinc finger sarcoma gene protein (PATZ1)
Protein Details			Pro Info Click to show the detail information of this Protein						[1]
Infection Cells			Huh7 cells (human liver cell line)  (CVCL_0336 )
Cell Originated Tissue			Liver
Interaction Score			P-value < 0.05
Description of Detection Method			RNA pull-down assays; liquid chromatography with tandem mass spectrometry (LC-MS/MS); Wilcoxon test; MS2 affinity purification coupled with liquid chromatography-mass spectrometry (MAMS)

Virus RNA Sequence Information (Source: GeneBank)

>MN996528.1 Severe acute respiratory syndrome coronavirus 2 isolate WIV04, complete genome ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAA CGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAAC TAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTG TTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTC CCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTAC GTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGG CTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGAT GCTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTCAGTACGGTC GTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAGTGGCTTACCGCAAGGTTCT TCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTTACGGCGCCGATCTAAAGTCATTTGACTTA GGCGACGAGCTTGGCACTGATCCTTATGAAGATTTTCAAGAAAACTGGAACACTAAACATAGCAGTGGTG TTACCCGTGAACTCATGCGTGAGCTTAACGGAGGGGCATACACTCGCTATGTCGATAACAACTTCTGTGG CCCTGATGGCTACCCTCTTGAGTGCATTAAAGACCTTCTAGCACGTGCTGGTAAAGCTTCATGCACTTTG TCCGAACAACTGGACTTTATTGACACTAAGAGGGGTGTATACTGCTGCCGTGAACATGAGCATGAAATTG CTTGGTACACGGAACGTTCTGAAAAGAGCTATGAATTGCAGACACCTTTTGAAATTAAATTGGCAAAGAA ATTTGACACCTTCAATGGGGAATGTCCAAATTTTGTATTTCCCTTAAATTCCATAATCAAGACTATTCAA CCAAGGGTTGAAAAGAAAAAGCTTGATGGCTTTATGGGTAGAATTCGATCTGTCTATCCAGTTGCGTCAC CAAATGAATGCAACCAAATGTGCCTTTCAACTCTCATGAAGTGTGATCATTGTGGTGAAACTTCATGGCA GACGGGCGATTTTGTTAAAGCCACTTGCGAATTTTGTGGCACTGAGAATTTGACTAAAGAAGGTGCCACT ACTTGTGGTTACTTACCCCAAAATGCTGTTGTTAAAATTTATTGTCCAGCATGTCACAATTCAGAAGTAG GACCTGAGCATAGTCTTGCCGAATACCATAATGAATCTGGCTTGAAAACCATTCTTCGTAAGGGTGGTCG CACTATTGCCTTTGGAGGCTGTGTGTTCTCTTATGTTGGTTGCCATAACAAGTGTGCCTATTGGGTTCCA CGTGCTAGCGCTAACATAGGTTGTAACCATACAGGTGTTGTTGGAGAAGGTTCCGAAGGTCTTAATGACA ACCTTCTTGAAATACTCCAAAAAGAGAAAGTCAACATCAATATTGTTGGTGACTTTAAACTTAATGAAGA GATCGCCATTATTTTGGCATCTTTTTCTGCTTCCACAAGTGCTTTTGTGGAAACTGTGAAAGGTTTGGAT TATAAAGCATTCAAACAAATTGTTGAATCCTGTGGTAATTTTAAAGTTACAAAAGGAAAAGCTAAAAAAG GTGCCTGGAATATTGGTGAACAGAAATCAATACTGAGTCCTCTTTATGCATTTGCATCAGAGGCTGCTCG TGTTGTACGATCAATTTTCTCCCGCACTCTTGAAACTGCTCAAAATTCTGTGCGTGTTTTACAGAAGGCC GCTATAACAATACTAGATGGAATTTCACAGTATTCACTGAGACTCATTGATGCTATGATGTTCACATCTG ATTTGGCTACTAACAATCTAGTTGTAATGGCCTACATTACAGGTGGTGTTGTTCAGTTGACTTCGCAGTG GCTAACTAACATCTTTGGCACTGTTTATGAAAAACTCAAACCCGTCCTTGATTGGCTTGAAGAGAAGTTT AAGGAAGGTGTAGAGTTTCTTAGAGACGGTTGGGAAATTGTTAAATTTATCTCAACCTGTGCTTGTGAAA TTGTCGGTGGACAAATTGTCACCTGTGCAAAGGAAATTAAGGAGAGTGTTCAGACATTCTTTAAGCTTGT AAATAAATTTTTGGCTTTGTGTGCTGACTCTATCATTATTGGTGGAGCTAAACTTAAAGCCTTGAATTTA GGTGAAACATTTGTCACGCACTCAAAGGGATTGTACAGAAAGTGTGTTAAATCCAGAGAAGAAACTGGCC TACTCATGCCTCTAAAAGCCCCAAAAGAAATTATCTTCTTAGAGGGAGAAACACTTCCCACAGAAGTGTT AACAGAGGAAGTTGTCTTGAAAACTGGTGATTTACAACCATTAGAACAACCTACTAGTGAAGCTGTTGAA GCTCCATTGGTTGGTACACCAGTTTGTATTAACGGGCTTATGTTGCTCGAAATCAAAGACACAGAAAAGT ACTGTGCCCTTGCACCTAATATGATGGTAACAAACAATACCTTCACACTCAAAGGCGGTGCACCAACAAA GGTTACTTTTGGTGATGACACTGTGATAGAAGTGCAAGGTTACAAGAGTGTGAATATCACTTTTGAACTT GATGAAAGGATTGATAAAGTACTTAATGAGAAGTGCTCTGCCTATACAGTTGAACTCGGTACAGAAGTAA ATGAGTTCGCCTGTGTTGTGGCAGATGCTGTCATAAAAACTTTGCAACCAGTATCTGAATTACTTACACC ACTGGGCATTGATTTAGATGAGTGGAGTATGGCTACATACTACTTATTTGATGAGTCTGGTGAGTTTAAA TTGGCTTCACATATGTATTGTTCTTTCTACCCTCCAGATGAGGATGAAGAAGAAGGTGATTGTGAAGAAG AAGAGTTTGAGCCATCAACTCAATATGAGTATGGTACTGAAGATGATTACCAAGGTAAACCTTTGGAATT TGGTGCCACTTCTGCTGCTCTTCAACCTGAAGAAGAGCAAGAAGAAGATTGGTTAGATGATGATAGTCAA CAAACTGTTGGTCAACAAGACGGCAGTGAGGACAATCAGACAACTACTATTCAAACAATTGTTGAGGTTC AACCTCAATTAGAGATGGAACTTACACCAGTTGTTCAGACTATTGAAGTGAATAGTTTTAGTGGTTATTT AAAACTTACTGACAATGTATACATTAAAAATGCAGACATTGTGGAAGAAGCTAAAAAGGTAAAACCAACA GTGGTTGTTAATGCAGCCAATGTTTACCTTAAACATGGAGGAGGTGTTGCAGGAGCCTTAAATAAGGCTA CTAACAATGCCATGCAAGTTGAATCTGATGATTACATAGCTACTAATGGACCACTTAAAGTGGGTGGTAG TTGTGTTTTAAGCGGACACAATCTTGCTAAACACTGTCTTCATGTTGTCGGCCCAAATGTTAACAAAGGT GAAGACATTCAACTTCTTAAGAGTGCTTATGAAAATTTTAATCAGCACGAAGTTCTACTTGCACCATTAT TATCAGCTGGTATTTTTGGTGCTGACCCTATACATTCTTTAAGAGTTTGTGTAGATACTGTTCGCACAAA TGTCTACTTAGCTGTCTTTGATAAAAATCTCTATGACAAACTTGTTTCAAGCTTTTTGGAAATGAAGAGT GAAAAGCAAGTTGAACAAAAGATCGCTGAGATTCCTAAAGAGGAAGTTAAGCCATTTATAACTGAAAGTA AACCTTCAGTTGAACAGAGAAAACAAGATGATAAGAAAATCAAAGCTTGTGTTGAAGAAGTTACAACAAC TCTGGAAGAAACTAAGTTCCTCACAGAAAACTTGTTACTTTATATTGACATTAATGGCAATCTTCATCCA GATTCTGCCACTCTTGTTAGTGACATTGACATCACTTTCTTAAAGAAAGATGCTCCATATATAGTGGGTG ATGTTGTTCAAGAGGGTGTTTTAACTGCTGTGGTTATACCTACTAAAAAGGCTGGTGGCACTACTGAAAT GCTAGCGAAAGCTTTGAGAAAAGTGCCAACAGACAATTATATAACCACTTACCCGGGTCAGGGTTTAAAT GGTTACACTGTAGAGGAGGCAAAGACAGTGCTTAAAAAGTGTAAAAGTGCCTTTTACATTCTACCATCTA TTATCTCTAATGAGAAGCAAGAAATTCTTGGAACTGTTTCTTGGAATTTGCGAGAAATGCTTGCACATGC AGAAGAAACACGCAAATTAATGCCTGTCTGTGTGGAAACTAAAGCCATAGTTTCAACTATACAGCGTAAA TATAAGGGTATTAAAATACAAGAGGGTGTGGTTGATTATGGTGCTAGATTTTACTTTTACACCAGTAAAA CAACTGTAGCGTCACTTATCAACACACTTAACGATCTAAATGAAACTCTTGTTACAATGCCACTTGGCTA TGTAACACATGGCTTAAATTTGGAAGAAGCTGCTCGGTATATGAGATCTCTCAAAGTGCCAGCTACAGTT TCTGTTTCTTCACCTGATGCTGTTACAGCGTATAATGGTTATCTTACTTCTTCTTCTAAAACACCTGAAG AACATTTTATTGAAACCATCTCACTTGCTGGTTCCTATAAAGATTGGTCCTATTCTGGACAATCTACACA ACTAGGTATAGAATTTCTTAAGAGAGGTGATAAAAGTGTATATTACACTAGTAATCCTACCACATTCCAC CTAGATGGTGAAGTTATCACCTTTGACAATCTTAAGACACTTCTTTCTTTGAGAGAAGTGAGGACTATTA AGGTGTTTACAACAGTAGACAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACA ACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGT AAAACATTTTATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTG ATCCTAGTTTTCTGGGTAGGTACATGTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAA TGGTTTAACTTCTATTAAATGGGCAGATAACAACTGTTATCTTGCCACTGCATTGTTAACACTCCAACAA ATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTACAGAGCAAGGGCTGGTGAAGCTGCTA ACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGATGTTAGAGAAACAAT GAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTGTAAAACTTGT GGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGGCACACTTTCTTATGAACAAT TTAAGAAAGGTGTTCAGATACCTTGTACGTGTGGTAAACAAGCTACAAAATATCTAGTACAACAGGAGTC ACCTTTTGTTATGATGTCAGCACCACCTGCTCAGTATGAACTTAAGCATGGTACATTTACTTGTGCTAGT GAGTACACTGGTAATTACCAGTGTGGTCACTATAAACATATAACTTCTAAAGAAACTTTGTATTGCATAG ACGGTGCTTTACTTACAAAGTCCTCAGAATACAAAGGTCCTATTACGGATGTTTTCTACAAAGAAAACAG TTACACAACAACCATAAAACCAGTTACTTATAAATTGGATGGTGTTGTTTGTACAGAAATTGACCCTAAG TTGGACAATTATTATAAGAAAGACAATTCTTATTTCACAGAGCAACCAATTGATCTTGTACCAAACCAAC CATATCCAAACGCAAGCTTCGATAATTTTAAGTTTGTATGTGATAATATCAAATTTGCTGATGATTTAAA CCAGTTAACTGGTTATAAGAAACCTGCTTCAAGAGAGCTTAAAGTTACATTTTTCCCTGACTTAAATGGT GATGTGGTGGCTATTGATTATAAACACTACACACCCTCTTTTAAGAAAGGAGCTAAATTGTTACATAAAC CTATTGTTTGGCATGTTAACAATGCAACTAATAAAGCCACGTATAAACCAAATACCTGGTGTATACGTTG TCTTTGGAGCACAAAACCAGTTGAAACATCAAATTCGTTTGATGTACTGAAGTCAGAGGACGCGCAGGGA ATGGATAATCTTGCCTGCGAAGATCTAAAACCAGTCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGA AAGACGTTCTTGAGTGTAATGTGAAAACTACCGAAGTTGTAGGAGACATTATACTTAAACCAGCAAATAA TAGTTTAAAAATTACAGAAGAGGTTGGCCACACAGATCTAATGGCTGCTTATGTAGACAATTCTAGTCTT ACTATTAAGAAACCTAATGAATTATCTAGAGTATTAGGTTTGAAAACCCTTGCTACTCATGGTTTAGCTG CTGTTAATAGTGTCCCTTGGGATACTATAGCTAATTATGCTAAGCCTTTTCTTAACAAAGTTGTTAGTAC AACTACTAACATAGTTACACGGTGTTTAAACCGTGTTTGTACTAATTATATGCCTTATTTCTTTACTTTA TTGCTACAATTGTGTACTTTTACTAGAAGTACAAATTCTAGAATTAAAGCATCTATGCCGACTACTATAG CAAAGAATACTGTTAAGAGTGTCGGTAAATTTTGTCTAGAGGCTTCATTTAATTATTTGAAGTCACCTAA TTTTTCTAAACTGATAAATATTATAATTTGGTTTTTACTATTAAGTGTTTGCCTAGGTTCTTTAATCTAC TCAACCGCTGCTTTAGGTGTTTTAATGTCTAATTTAGGCATGCCTTCTTACTGTACTGGTTACAGAGAAG GCTATTTGAACTCTACTAATGTCACTATTGCAACCTACTGTACTGGTTCTATACCTTGTAGTGTTTGTCT TAGTGGTTTAGATTCTTTAGACACCTATCCTTCTTTAGAAACTATACAAATTACCATTTCATCTTTTAAA TGGGATTTAACTGCTTTTGGCTTAGTTGCAGAGTGGTTTTTGGCATATATTCTTTTCACTAGGTTTTTCT ATGTACTTGGATTGGCTGCAATCATGCAATTGTTTTTCAGCTATTTTGCAGTACATTTTATTAGTAATTC TTGGCTTATGTGGTTAATAATTAATCTTGTACAAATGGCCCCGATTTCAGCTATGGTTAGAATGTACATC TTCTTTGCATCATTTTATTATGTATGGAAAAGTTATGTGCATGTTGTAGACGGTTGTAATTCATCAACTT GTATGATGTGTTACAAACGTAATAGAGCAACAAGAGTCGAATGTACAACTATTGTTAATGGTGTTAGAAG GTCCTTTTATGTCTATGCTAATGGAGGTAAAGGCTTTTGCAAACTACACAATTGGAATTGTGTTAATTGT GATACATTCTGTGCTGGTAGTACATTTATTAGTGATGAAGTTGCGAGAGACTTGTCACTACAGTTTAAAA GACCAATAAATCCTACTGACCAGTCTTCTTACATCGTTGATAGTGTTACAGTGAAGAATGGTTCCATCCA TCTTTACTTTGATAAAGCTGGTCAAAAGACTTATGAAAGACATTCTCTCTCTCATTTTGTTAACTTAGAC AACCTGAGAGCTAATAACACTAAAGGTTCATTGCCTATTAATGTTATAGTTTTTGATGGTAAATCAAAAT GTGAAGAATCATCTGCAAAATCAGCGTCTGTTTACTACAGTCAGCTTATGTGTCAACCTATACTGTTACT AGATCAGGCATTAGTGTCTGATGTTGGTGATAGTGCGGAAGTTGCAGTTAAAATGTTTGATGCTTACGTT AATACGTTTTCATCAACTTTTAACGTACCAATGGAAAAACTCAAAACACTAGTTGCAACTGCAGAAGCTG AACTTGCAAAGAATGTGTCCTTAGACAATGTCTTATCTACTTTTATTTCAGCAGCTCGGCAAGGGTTTGT TGATTCAGATGTAGAAACTAAAGATGTTGTTGAATGTCTTAAATTGTCACATCAATCTGACATAGAAGTT ACTGGCGATAGTTGTAATAACTATATGCTCACCTATAACAAAGTTGAAAACATGACACCCCGTGACCTTG GTGCTTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACATTGCTTTGAT ATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAACAAATACGTAGTGCTGCTAAAAAG AATAACTTACCTTTTAAGTTGACATGTGCAACTACTAGACAAGTTGTTAATGTTGTAACAACAAAGATAG CACTTAAGGGTGGTAAAATTGTTAATAATTGGTTGAAGCAGTTAATTAAAGTTACACTTGTGTTCCTTTT TGTTGCTGCTATTTTCTATTTAATAACACCTGTTCATGTCATGTCTAAACATACTGACTTTTCAAGTGAA ATCATAGGATACAAGGCTATTGATGGTGGTGTCACTCGTGACATAGCATCTACAGATACTTGTTTTGCTA ACAAACATGCTGATTTTGACACATGGTTTAGCCAGCGTGGTGGTAGTTATACTAATGACAAAGCTTGCCC ATTGATTGCTGCAGTCATAACAAGAGAAGTGGGTTTTGTCGTGCCTGGTTTGCCTGGCACGATATTACGC ACAACTAATGGTGACTTTTTGCATTTCTTACCTAGAGTTTTTAGTGCAGTTGGTAACATCTGTTACACAC CATCAAAACTTATAGAGTACACTGACTTTGCAACATCAGCTTGTGTTTTGGCTGCTGAATGTACAATTTT TAAAGATGCTTCTGGTAAGCCAGTACCATATTGTTATGATACCAATGTACTAGAAGGTTCTGTTGCTTAT GAAAGTTTACGCCCTGACACACGTTATGTGCTCATGGATGGCTCTATTATTCAATTTCCTAACACCTACC TTGAAGGTTCTGTTAGAGTGGTAACAACTTTTGATTCTGAGTACTGTAGGCACGGCACTTGTGAAAGATC AGAAGCTGGTGTTTGTGTATCTACTAGTGGTAGATGGGTACTTAACAATGATTATTACAGATCTTTACCA GGAGTTTTCTGTGGTGTAGATGCTGTAAATTTACTTACTAATATGTTTACACCACTAATTCAACCTATTG GTGCTTTGGACATATCAGCATCTATAGTAGCTGGTGGTATTGTAGCTATCGTAGTAACATGCCTTGCCTA CTATTTTATGAGGTTTAGAAGAGCTTTTGGTGAATACAGTCATGTAGTTGCCTTTAATACTTTACTATTC CTTATGTCATTCACTGTACTCTGTTTAACACCAGTTTACTCATTCTTACCTGGTGTTTATTCTGTTATTT ACTTGTACTTGACATTTTATCTTACTAATGATGTTTCTTTTTTAGCACATATTCAGTGGATGGTTATGTT CACACCTTTAGTACCTTTCTGGATAACAATTGCTTATATCATTTGTATTTCCACAAAGCATTTCTATTGG TTCTTTAGTAATTACCTAAAGAGACGTGTAGTCTTTAATGGTGTTTCCTTTAGTACTTTTGAAGAAGCTG CGCTGTGCACCTTTTTGTTAAATAAAGAAATGTATCTAAAGTTGCGTAGTGATGTGCTATTACCTCTTAC GCAATATAATAGATACTTAGCTCTTTATAATAAGTACAAGTATTTTAGTGGAGCAATGGATACAACTAGC TACAGAGAAGCTGCTTGTTGTCATCTCGCAAAGGCTCTCAATGACTTCAGTAACTCAGGTTCTGATGTTC TTTACCAACCACCACAAACCTCTATCACCTCAGCTGTTTTGCAGAGTGGTTTTAGAAAAATGGCATTCCC ATCTGGTAAAGTTGAGGGTTGTATGGTACAAGTAACTTGTGGTACAACTACACTTAACGGTCTTTGGCTT GATGACGTAGTTTACTGTCCAAGACATGTGATCTGCACCTCTGAAGACATGCTTAACCCTAATTATGAAG ATTTACTCATTCGTAAGTCTAATCATAATTTCTTGGTACAGGCTGGTAATGTTCAACTCAGGGTTATTGG ACATTCTATGCAAAATTGTGTACTTAAGCTTAAGGTTGATACAGCCAATCCTAAGACACCTAAGTATAAG TTTGTTCGCATTCAACCAGGACAGACTTTTTCAGTGTTAGCTTGTTACAATGGTTCACCATCTGGTGTTT ACCAATGTGCTATGAGGCCCAATTTCACTATTAAGGGTTCATTCCTTAATGGTTCATGTGGTAGTGTTGG TTTTAACATAGATTATGACTGTGTCTCTTTTTGTTACATGCACCATATGGAATTACCAACTGGAGTTCAT GCTGGCACAGACTTAGAAGGTAACTTTTATGGACCTTTTGTTGACAGGCAAACAGCACAAGCAGCTGGTA CGGACACAACTATTACAGTTAATGTTTTAGCTTGGTTGTACGCTGCTGTTATAAATGGAGACAGGTGGTT TCTCAATCGATTTACCACAACTCTTAATGACTTTAACCTTGTGGCTATGAAGTACAATTATGAACCTCTA ACACAAGACCATGTTGACATACTAGGACCTCTTTCTGCTCAAACTGGAATTGCCGTTTTAGATATGTGTG CTTCATTAAAAGAATTACTGCAAAATGGTATGAATGGACGTACCATATTGGGTAGTGCTTTATTAGAAGA TGAATTTACACCTTTTGATGTTGTTAGACAATGCTCAGGTGTTACTTTCCAAAGTGCAGTGAAAAGAACA ATCAAGGGTACACACCACTGGTTGTTACTCACAATTTTGACTTCACTTTTAGTTTTAGTCCAGAGTACTC AATGGTCTTTGTTCTTTTTTTTGTATGAAAATGCCTTTTTACCTTTTGCTATGGGTATTATTGCTATGTC TGCTTTTGCAATGATGTTTGTCAAACATAAGCATGCATTTCTCTGTTTGTTTTTGTTACCTTCTCTTGCC ACTGTAGCTTATTTTAATATGGTCTATATGCCTGCTAGTTGGGTGATGCGTATTATGACATGGTTGGATA TGGTTGATACTAGTTTGTCTGGTTTTAAGCTAAAAGACTGTGTTATGTATGCATCAGCTGTAGTGTTACT AATCCTTATGACAGCAAGAACTGTGTATGATGATGGTGCTAGGAGAGTGTGGACACTTATGAATGTCTTG ACACTCGTTTATAAAGTTTATTATGGTAATGCTTTAGATCAAGCCATTTCCATGTGGGCTCTTATAATCT CTGTTACTTCTAACTACTCAGGTGTAGTTACAACTGTCATGTTTTTGGCCAGAGGTATTGTTTTTATGTG TGTTGAGTATTGCCCTATTTTCTTCATAACTGGTAATACACTTCAGTGTATAATGCTAGTTTATTGTTTC TTAGGCTATTTTTGTACTTGTTACTTTGGCCTCTTTTGTTTACTCAACCGCTACTTTAGACTGACTCTTG GTGTTTATGATTACTTAGTTTCTACACAGGAGTTTAGATATATGAATTCACAGGGACTACTCCCACCCAA GAATAGCATAGATGCCTTCAAACTCAACATTAAATTGTTGGGTGTTGGTGGCAAACCTTGTATCAAAGTA GCCACTGTACAGTCTAAAATGTCAGATGTAAAGTGCACATCAGTAGTCTTACTCTCAGTTTTGCAACAAC TCAGAGTAGAATCATCATCTAAATTGTGGGCTCAATGTGTCCAGTTACACAATGACATTCTCTTAGCTAA AGATACTACTGAAGCCTTTGAAAAAATGGTTTCACTACTTTCTGTTTTGCTTTCCATGCAGGGTGCTGTA GACATAAACAAGCTTTGTGAAGAAATGCTGGACAACAGGGCAACCTTACAAGCTATAGCCTCAGAGTTTA GTTCCCTTCCATCATATGCAGCTTTTGCTACTGCTCAAGAAGCTTATGAGCAGGCTGTTGCTAATGGTGA TTCTGAAGTTGTTCTTAAAAAGTTGAAGAAGTCTTTGAATGTGGCTAAATCTGAATTTGACCGTGATGCA GCCATGCAACGTAAGTTGGAAAAGATGGCTGATCAAGCTATGACCCAAATGTATAAACAGGCTAGATCTG AGGACAAGAGGGCAAAAGTTACTAGTGCTATGCAGACAATGCTTTTCACTATGCTTAGAAAGTTGGATAA TGATGCACTCAACAACATTATCAACAATGCAAGAGATGGTTGTGTTCCCTTGAACATAATACCTCTTACA ACAGCAGCCAAACTAATGGTTGTCATACCAGACTATAACACATATAAAAATACGTGTGATGGTACAACAT TTACTTATGCATCAGCATTGTGGGAAATCCAACAGGTTGTAGATGCAGATAGTAAAATTGTTCAACTTAG TGAAATTAGTATGGACAATTCACCTAATTTAGCATGGCCTCTTATTGTAACAGCTTTAAGGGCCAATTCT GCTGTCAAATTACAGAATAATGAGCTTAGTCCTGTTGCACTACGACAGATGTCTTGTGCTGCCGGTACTA CACAAACTGCTTGCACTGATGACAATGCGTTAGCTTACTACAACACAACAAAGGGAGGTAGGTTTGTACT TGCACTGTTATCCGATTTACAGGATTTGAAATGGGCTAGATTCCCTAAGAGTGATGGAACTGGTACTATC TATACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCTAAAGGTCCTAAAGTGAAGTATTTAT ACTTTATTAAAGGATTAAACAACCTAAATAGAGGTATGGTACTTGGTAGTTTAGCTGCCACAGTACGTCT ACAAGCTGGTAATGCAACAGAAGTGCCTGCCAATTCAACTGTATTATCTTTCTGTGCTTTTGCTGTAGAT GCTGCTAAAGCTTACAAAGATTATCTAGCTAGTGGGGGACAACCAATCACTAATTGTGTTAAGATGTTGT GTACACACACTGGTACTGGTCAGGCAATAACAGTTACACCGGAAGCCAATATGGATCAAGAATCCTTTGG TGGTGCATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTA AAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAG TCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCA GTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCA CAGGCACTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTTTTGCTAA ATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGACAATTTAATTGATTCTTACTTT GTAGTTAAGAGACACACTTTCTCTAACTACCAACATGAAGAAACAATTTATAATTTACTTAAGGATTGTC CAGCTGTTGCTAAACATGACTTCTTTAAGTTTAGAATAGACGGTGACATGGTACCACATATATCACGTCA ACGTCTTACTAAATACACAATGGCAGACCTCGTCTATGCTTTAAGGCATTTTGATGAAGGTAATTGTGAC ACATTAAAAGAAATACTTGTCACATACAATTGTTGTGATGATGATTATTTCAATAAAAAGGACTGGTATG ATTTTGTAGAAAACCCAGATATATTACGCGTATACGCCAACTTAGGTGAACGTGTACGCCAAGCTTTGTT AAAAACAGTACAATTCTGTGATGCCATGCGAAATGCTGGTATTGTTGGTGTACTGACATTAGATAATCAA GATCTCAATGGTAACTGGTATGATTTCGGTGATTTCATACAAACCACGCCAGGTAGTGGAGTTCCTGTTG TAGATTCTTATTATTCATTGTTAATGCCTATATTAACCTTGACCAGGGCTTTAACTGCAGAGTCACATGT TGACACTGACTTAACAAAGCCTTACATTAAGTGGGATTTGTTAAAATATGACTTCACGGAAGAGAGGTTA AAACTCTTTGACCGTTATTTTAAATATTGGGATCAGACATACCACCCAAATTGTGTTAACTGTTTGGATG ACAGATGCATTCTGCATTGTGCAAACTTTAATGTTTTATTCTCTACAGTGTTCCCACCTACAAGTTTTGG ACCACTAGTGAGAAAAATATTTGTTGATGGTGTTCCATTTGTAGTTTCAACTGGATACCACTTCAGAGAG CTAGGTGTTGTACATAATCAGGATGTAAACTTACATAGCTCTAGACTTAGTTTTAAGGAATTACTTGTGT ATGCTGCTGACCCTGCTATGCACGCTGCTTCTGGTAATCTATTACTAGATAAACGCACTACGTGCTTTTC AGTAGCTGCACTTACTAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTTAACAAAGACTTCTAT GACTTTGCTGTGTCTAAGGGTTTCTTTAAGGAAGGAAGTTCTGTTGAATTAAAACACTTCTTCTTTGCTC AGGATGGTAATGCTGCTATCAGCGATTATGACTACTATCGTTATAATCTACCAACAATGTGTGATATCAG ACAACTACTATTTGTAGTTGAAGTTGTTGATAAGTACTTTGATTGTTACGATGGTGGCTGTATTAATGCT AACCAAGTCATCGTCAACAACCTAGACAAATCAGCTGGTTTTCCATTTAATAAATGGGGTAAGGCTAGAC TTTATTATGATTCAATGAGTTATGAGGATCAAGATGCACTTTTCGCATATACAAAACGTAATGTCATCCC TACTATAACTCAAATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTC TCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAATCAATAGCCGCCACTAGAG GAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAG TGATGTAGAAAACCCTCACCTTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTT AGAATTATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTGTCACACCGTTTCTATA GATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACC AGGTGGAACCTCATCAGGAGATGCCACAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTC ACGGCCAATGTTAATGCACTTTTATCTACTGATGGTAACAAAATTGCCGATAAGTATGTCCGCAATTTAC AACACAGACTTTATGAGTGTCTCTATAGAAATAGAGATGTTGACACAGACTTTGTGAATGAGTTTTACGC ATATTTGCGTAAACATTTCTCAATGATGATACTCTCTGACGATGCTGTTGTGTGTTTCAATAGCACTTAT GCATCTCAAGGTCTAGTGGCTAGCATAAAGAACTTTAAGTCAGTTCTTTATTATCAAAACAATGTTTTTA TGTCTGAAGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCATGAATTTTGCTCTCAACATAC AATGCTAGTTAAACAGGGTGATGATTATGTGTACCTTCCTTACCCAGATCCATCAAGAATCCTAGGGGCC GGCTGTTTTGTAGATGATATCGTAAAAACAGATGGTACACTTATGATTGAACGGTTCGTGTCTTTAGCTA TAGATGCTTACCCACTTACTAAACATCCTAATCAGGAGTATGCTGATGTCTTTCATTTGTACTTACAATA CATAAGAAAGCTACATGATGAGTTAACAGGACACATGTTAGACATGTATTCTGTTATGCTTACTAATGAT AACACTTCAAGGTATTGGGAACCTGAGTTTTATGAGGCTATGTACACACCGCATACAGTCTTACAGGCTG TTGGGGCTTGTGTTCTTTGCAATTCACAGACTTCATTAAGATGTGGTGCTTGCATACGTAGACCATTCTT ATGTTGTAAATGCTGTTACGACCATGTCATATCAACATCACATAAATTAGTCTTGTCTGTTAATCCGTAT GTTTGCAATGCTCCAGGTTGTGATGTCACAGATGTGACTCAACTTTACTTAGGAGGTATGAGCTATTATT GTAAATCACATAAACCACCCATTAGTTTTCCATTGTGTGCTAATGGACAAGTTTTTGGTTTATATAAAAA TACATGTGTTGGTAGCGATAATGTTACTGACTTTAATGCAATTGCAACATGTGACTGGACAAATGCTGGT GATTACATTTTAGCTAACACCTGTACTGAAAGACTCAAGCTTTTTGCAGCAGAAACGCTCAAAGCTACTG AGGAGACATTTAAACTGTCTTATGGTATTGCTACTGTACGTGAAGTGCTGTCTGACAGAGAATTACATCT TTCATGGGAAGTTGGTAAACCTAGACCACCACTTAACCGAAATTATGTCTTTACTGGTTATCGTGTAACT AAAAACAGTAAAGTACAAATAGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTTTACC GAGGTACAACAACTTACAAATTAAATGTTGGTGATTATTTTGTGCTGACATCACATACAGTAATGCCATT AAGTGCACCTACACTAGTGCCACAAGAGCACTATGTTAGAATTACTGGCTTATACCCAACACTCAATATC TCAGATGAGTTTTCTAGCAATGTTGCAAATTATCAAAAGGTTGGTATGCAAAAGTATTCTACACTCCAGG GACCACCTGGTACTGGTAAGAGTCATTTTGCTATTGGCCTAGCTCTCTACTACCCTTCTGCTCGCATAGT GTATACAGCTTGCTCTCATGCCGCTGTTGATGCACTATGTGAGAAGGCATTAAAATATTTGCCTATAGAT AAATGTAGTAGAATTATACCTGCACGTGCTCGTGTAGAGTGTTTTGATAAATTCAAAGTGAATTCAACAT TAGAACAGTATGTCTTTTGTACTGTAAATGCATTGCCTGAGACGACAGCAGATATAGTTGTCTTTGATGA AATTTCAATGGCCACAAATTATGATTTGAGTGTTGTCAATGCCAGATTACGTGCTAAGCACTATGTGTAC ATTGGCGACCCTGCTCAATTACCTGCACCACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATT TCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCC TGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGATAATAAGCTTAAAGCACATAAAGACAAATCA GCTCAATGCTTTAAAATGTTTTATAAGGGTGTTATCACGCATGATGTTTCATCTGCAATTAACAGGCCAC AAATAGGCGTGGTAAGAGAATTCCTTACACGTAACCCTGCTTGGAGAAAAGCTGTCTTTATTTCACCTTA TAATTCACAGAATGCTGTAGCCTCAAAGATTTTGGGACTACCAACTCAAACTGTTGATTCATCACAGGGC TCAGAATATGACTATGTCATATTCACTCAAACCACTGAAACAGCTCACTCTTGTAATGTAAACAGATTTA ATGTTGCTATTACCAGAGCAAAAGTAGGCATACTTTGCATAATGTCTGATAGAGACCTTTATGACAAGTT GCAATTTACAAGTCTTGAAATTCCACGTAGGAATGTGGCAACTTTACAAGCTGAAAATGTAACAGGACTC TTTAAAGATTGTAGTAAGGTAATCACTGGGTTACATCCTACACAGGCACCTACACACCTCAGTGTTGACA CTAAATTCAAAACTGAAGGTTTATGTGTTGACATACCTGGCATACCTAAGGACATGACCTATAGAAGACT CATCTCTATGATGGGTTTTAAAATGAATTATCAAGTTAATGGTTACCCTAACATGTTTATCACCCGCGAA GAAGCTATAAGACATGTACGTGCATGGATTGGCTTCGATGTCGAGGGGTGTCATGCTACTAGAGAAGCTG TTGGTACCAATTTACCTTTACAGCTAGGTTTTTCTACAGGTGTTAACCTAGTTGCTGTACCTACAGGTTA TGTTGATACACCTAATAATACAGATTTTTCCAGAGTTAGTGCTAAACCACCGCCTGGAGATCAATTTAAA CACCTCATACCACTTATGTACAAAGGACTTCCTTGGAATGTAGTGCGTATAAAGATTGTACAAATGTTAA GTGACACACTTAAAAATCTCTCTGACAGAGTCGTATTTGTCTTATGGGCACATGGCTTTGAGTTGACATC TATGAAGTATTTTGTGAAAATAGGACCTGAGCGCACCTGTTGTCTATGTGATAGACGTGCCACATGCTTT TCCACTGCTTCAGACACTTATGCCTGTTGGCATCATTCTATTGGATTTGATTACGTCTATAATCCGTTTA TGATTGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCA TGGTAATGCACATGTAGCTAGTTGTGATGCAATCATGACTAGGTGTCTAGCTGTCCACGAGTGCTTTGTT AAGCGTGTTGACTGGACTATTGAATATCCTATAATTGGTGATGAACTGAAGATTAATGCGGCTTGTAGAA AGGTTCAACACATGGTTGTTAAAGCTGCATTATTAGCAGACAAATTCCCAGTTCTTCACGACATTGGTAA CCCTAAAGCTATTAAGTGTGTACCTCAAGCTGATGTAGAATGGAAGTTCTATGATGCACAGCCTTGTAGT GACAAAGCTTATAAAATAGAAGAATTATTCTATTCTTATGCCACACATTCTGACAAATTCACAGATGGTG TATGCCTATTTTGGAATTGCAATGTCGATAGATATCCTGCTAATTCCATTGTTTGTAGATTTGACACTAG AGTGCTATCTAACCTTAACTTGCCTGGTTGTGATGGTGGCAGTTTGTATGTAAATAAACATGCATTCCAC ACACCAGCTTTTGATAAAAGTGCTTTTGTTAATTTAAAACAATTACCATTTTTCTATTACTCTGACAGTC CATGTGAGTCTCATGGAAAACAAGTAGTGTCAGATATAGATTATGTACCACTAAAGTCTGCTACGTGTAT AACACGTTGCAATTTAGGTGGTGCTGTCTGTAGACATCATGCTAATGAGTACAGATTGTATCTCGATGCT TATAACATGATGATCTCAGCTGGCTTTAGCTTGTGGGTTTACAAACAATTTGATACTTATAACCTCTGGA ACACTTTTACAAGACTTCAGAGTTTAGAAAATGTGGCTTTTAATGTTGTAAATAAGGGACACTTTGATGG ACAACAGGGTGAAGTACCAGTTTCTATCATTAATAACACTGTTTACACAAAAGTTGATGGTGTTGATGTA GAATTGTTTGAAAATAAAACAACATTACCTGTTAATGTAGCATTTGAGCTTTGGGCTAAGCGCAACATTA AACCAGTACCAGAGGTGAAAATACTCAATAATTTGGGTGTGGACATTGCTGCTAATACTGTGATCTGGGA CTACAAAAGAGATGCTCCAGCACATATATCTACTATTGGTGTTTGTTCTATGACTGACATAGCCAAGAAA CCAACTGAAACGATTTGTGCACCACTCACTGTCTTTTTTGATGGTAGAGTTGATGGTCAAGTAGACTTAT TTAGAAATGCCCGTAATGGTGTTCTTATTACAGAAGGTAGTGTTAAAGGTTTACAACCATCTGTAGGTCC CAAACAAGCTAGTCTTAATGGAGTCACATTAATTGGAGAAGCCGTAAAAACACAGTTCAATTATTATAAG AAAGTTGATGGTGTTGTCCAACAATTACCTGAAACTTACTTTACTCAGAGTAGAAATTTACAAGAATTTA AACCCAGGAGTCAAATGGAAATTGATTTCTTAGAATTAGCTATGGATGAATTCATTGAACGGTATAAATT AGAAGGCTATGCCTTCGAACATATCGTTTATGGAGATTTTAGTCATAGTCAGTTAGGTGGTTTACATCTA CTGATTGGACTAGCTAAACGTTTTAAGGAATCACCTTTTGAATTAGAAGATTTTATTCCTATGGACAGTA CAGTTAAAAACTATTTCATAACAGATGCGCAAACAGGTTCATCTAAGTGTGTGTGTTCTGTTATTGATTT ATTACTTGATGATTTTGTTGAAATAATAAAATCCCAAGATTTATCTGTAGTTTCTAAGGTTGTCAAAGTG ACTATTGACTATACAGAAATTTCATTTATGCTTTGGTGTAAAGATGGCCATGTAGAAACATTTTACCCAA AATTACAATCTAGTCAAGCGTGGCAACCGGGTGTTGCTATGCCTAATCTTTACAAAATGCAAAGAATGCT ATTAGAAAAGTGTGACCTTCAAAATTATGGTGATAGTGCAACATTACCTAAAGGCATAATGATGAATGTC GCAAAATATACTCAACTGTGTCAATATTTAAACACATTAACATTAGCTGTACCCTATAATATGAGAGTTA TACATTTTGGTGCTGGTTCTGATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAGACAGTGGTTGCCTAC GGGTACGCTGCTTGTCGATTCAGATCTTAATGACTTTGTCTCTGATGCAGATTCAACTTTGATTGGTGAT TGTGCAACTGTACATACAGCTAATAAATGGGATCTCATTATTAGTGATATGTACGACCCTAAGACTAAAA ATGTTACAAAAGAAAATGACTCTAAAGAGGGTTTTTTCACTTACATTTGTGGGTTTATACAACAAAAGCT AGCTCTTGGAGGTTCCGTGGCTATAAAGATAACAGAACATTCTTGGAATGCTGATCTTTATAAGCTCATG GGACACTTCGCATGGTGGACAGCCTTTGTTACTAATGTGAATGCGTCATCATCTGAAGCATTTTTAATTG GATGTAATTATCTTGGCAAACCACGCGAACAAATAGATGGTTATGTCATGCATGCAAATTACATATTTTG GAGGAATACAAATCCAATTCAGTTGTCTTCCTATTCTTTATTTGACATGAGTAAATTTCCCCTTAAATTA AGGGGTACTGCTGTTATGTCTTTAAAAGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAG GTAGACTTATAATTAGAGAAAACAACAGAGTTGTTATTTCTAGTGATGTTCTTGTTAACAACTAAACGAA CAATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCA ATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCA GTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATG TCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGC TTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCC CTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCAT TTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGC GAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTC AAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTA TTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTAT TAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCA GGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATA ATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTT GAAATCCTTCACTGTAGAAAAAGGAATCTATCAAACTTCTAACTTTAGAGTCCAACCAACAGAATCTATT GTTAGATTTCCTAATATTACAAACTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTG TTTATGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCCTATATAATTCCGCATC ATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTACTAAATTAAATGATCTCTGCTTTACTAATGTCTAT GCAGATTCATTTGTAATTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGATTGCTG ATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTC TAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGA GATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGTTTTAATTGTTACT TTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACT TTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGACCTAAAAAGTCTACTAATTTGGTTAAAAAC AAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTC TGCCTTTCCAACAATTTGGCAGAGACATTGCTGACACTACTGATGCTGTCCGTGATCCACAGACACTTGA GATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAAC CAGGTTGCTGTTCTTTATCAGGATGTTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTA CTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGC TGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACT CAGACTAATTCTCCTCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTG GTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTAC CACAGAAATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTACATTTGTGGTGATTCA ACTGAATGCAGCAATCTTTTGTTGCAATATGGCAGTTTTTGTACACAATTAAACCGTGCTTTAACTGGAA TAGCTGTTGAACAAGACAAAAACACCCAAGAAGTTTTTGCACAAGTCAAACAAATTTACAAAACACCACC AATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACCAAGCAAGAGGTCA TTTATTGAAGATCTACTTTTCAACAAAGTGACACTTGCAGATGCTGGCTTCATCAAACAATATGGTGATT GCCTTGGTGATATTGCTGCTAGAGACCTCATTTGTGCACAAAAGTTTAACGGCCTTACTGTTTTGCCACC TTTGCTCACAGATGAAATGATTGCTCAATACACTTCTGCACTGTTAGCGGGTACAATCACTTCTGGTTGG ACCTTTGGTGCAGGTGCTGCATTACAAATACCATTTGCTATGCAAATGGCTTATAGGTTTAATGGTATTG GAGTTACACAGAATGTTCTCTATGAGAACCAAAAATTGATTGCCAACCAATTTAATAGTGCTATTGGCAA AATTCAAGACTCACTTTCTTCCACAGCAAGTGCACTTGGAAAACTTCAAGATGTGGTCAACCAAAATGCA CAAGCTTTAAACACGCTTGTTAAACAACTTAGCTCCAATTTTGGTGCAATTTCAAGTGTTTTAAATGATA TCCTTTCACGTCTTGACAAAGTTGAGGCTGAAGTGCAAATTGATAGGTTGATCACAGGCAGACTTCAAAG TTTGCAGACATATGTGACTCAACAATTAATTAGAGCTGCAGAAATCAGAGCTTCTGCTAATCTTGCTGCT ACTAAAATGTCAGAGTGTGTACTTGGACAATCAAAAAGAGTTGATTTTTGTGGAAAGGGCTATCATCTTA TGTCCTTCCCTCAGTCAGCACCTCATGGTGTAGTCTTCTTGCATGTGACTTATGTCCCTGCACAAGAAAA GAACTTCACAACTGCTCCTGCCATTTGTCATGATGGAAAAGCACACTTTCCTCGTGAAGGTGTCTTTGTT TCAAATGGCACACACTGGTTTGTAACACAAAGGAATTTTTATGAACCACAAATCATTACTACAGACAACA CATTTGTGTCTGGTAACTGTGATGTTGTAATAGGAATTGTCAACAACACAGTTTATGATCCTTTGCAACC TGAATTAGACTCATTCAAGGAGGAGTTAGATAAATATTTTAAGAATCATACATCACCAGATGTTGATTTA GGTGACATCTCTGGCATTAATGCTTCAGTTGTAAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTTG CCAAGAATTTAAATGAATCTCTCATCGATCTCCAAGAACTTGGAAAGTATGAGCAGTATATAAAATGGCC ATGGTACATTTGGCTAGGTTTTATAGCTGGCTTGATTGCCATAGTAATGGTGACAATTATGCTTTGCTGT ATGACCAGTTGCTGTAGTTGTCTCAAGGGCTGTTGTTCTTGTGGATCCTGCTGCAAATTTGATGAAGACG ACTCTGAGCCAGTGCTCAAAGGAGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTATGAGA ATCTTCACAATTGGAACTGTAACTTTGAAGCAAGGTGAAATCAAGGATGCTACTCCTTCAGATTTTGTTC GCGCTACTGCAACGATACCGATACAAGCCTCACTCCCTTTCGGATGGCTTATTGTTGGCGTTGCACTTCT TGCTGTTTTTCAGAGCGCTTCCAAAATCATAACCCTCAAAAAGAGATGGCAACTAGCACTCTCCAAGGGT GTTCACTTTGTTTGCAACTTGCTGTTGTTGTTTGTAACAGTTTACTCACACCTTTTGCTCGTTGCTGCTG GCCTTGAAGCCCCTTTTCTCTATCTTTATGCTTTAGTCTACTTCTTGCAGAGTATAAACTTTGTAAGAAT AATAATGAGGCTTTGGCTTTGCTGGAAATGCCGTTCCAAAAACCCATTACTTTATGATGCCAACTATTTT CTTTGCTGGCATACTAATTGTTACGACTATTGTATACCTTACAATAGTGTAACTTCTTCAATTGTCATTA CTTCAGGTGATGGCACAACAAGTCCTATTTCTGAACATGACTACCAGATTGGTGGTTATACTGAAAAATG GGAATCTGGAGTAAAAGACTGTGTTGTATTACACAGTTACTTCACTTCAGACTATTACCAGCTGTACTCA ACTCAATTGAGTACAGACACTGGTGTTGAACATGTTACCTTCTTCATCTACAATAAAATTGTTGATGAGC CTGAAGAACATGTCCAAATTCACACAATCGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAAT TTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTAAGCACAAGCTGATGAGTACGAACTTATGTAC TCATTCGTTTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTAT TCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGCAATATTGTTAACGT GAGTCTTGTAAAACCTTCTTTTTACGTTTACTCTCGTGTTAAAAATCTGAATTCTTCTAGAGTTCCTGAT CTTCTGGTCTAAACGAACTAAATATTATATTAGTTTTTCTGTTTGGAACTTTAATTTTAGCCATGGCAGA TTCCAACGGTACTATTACCGTTGAAGAGCTTAAAAAGCTCCTTGAACAATGGAACCTAGTAATAGGTTTC CTATTCCTTACATGGATTTGTCTTCTACAATTTGCCTATGCCAACAGGAATAGGTTTTTGTATATAATTA AGTTAATTTTCCTCTGGCTGTTATGGCCAGTAACTTTAGCTTGTTTTGTGCTTGCTGCTGTTTACAGAAT AAATTGGATCACCGGTGGAATTGCTATCGCAATGGCTTGTCTTGTAGGCTTGATGTGGCTCAGCTACTTC ATTGCTTCTTTCAGACTGTTTGCGCGTACGCGTTCCATGTGGTCATTCAATCCAGAAACTAACATTCTTC TCAACGTGCCACTCCATGGCACTATTCTGACCAGACCGCTTCTAGAAAGTGAACTCGTAATCGGAGCTGT GATCCTTCGTGGACATCTTCGTATTGCTGGACACCATCTAGGACGCTGTGACATCAAGGACCTGCCTAAA GAAATCACTGTTGCTACATCACGAACGCTTTCTTATTACAAATTGGGAGCTTCGCAGCGTGTAGCAGGTG ACTCAGGTTTTGCTGCATACAGTCGCTACAGGATTGGCAACTATAAATTAAACACAGACCATTCCAGTAG CAGTGACAATATTGCTTTGCTTGTACAGTAAGTGACAACAGATGTTTCATCTCGTTGACTTTCAGGTTAC TATAGCAGAGATATTACTAATTATTATGAGGACTTTTAAAGTTTCCATTTGGAATCTTGATTACATCATA AACCTCATAATTAAAAATTTATCTAAGTCACTAACTGAGAATAAATATTCTCAATTAGATGAAGAGCAAC CAATGGAGATTGATTAAACGAACATGAAAATTATTCTTTTCTTGGCACTGATAACACTCGCTACTTGTGA GCTTTATCACTACCAAGAGTGTGTTAGAGGTACAACAGTACTTTTAAAAGAACCTTGCTCTTCTGGAACA TACGAGGGCAATTCACCATTTCATCCTCTAGCTGATAACAAATTTGCACTGACTTGCTTTAGCACTCAAT TTGCTTTTGCTTGTCCTGACGGCGTAAAACACGTCTATCAGTTACGTGCCAGATCAGTTTCACCTAAACT GTTCATCAGACAAGAGGAAGTTCAAGAACTTTACTCTCCAATTTTTCTTATTGTTGCGGCAATAGTGTTT ATAACACTTTGCTTCACACTCAAAAGAAAGACAGAATGATTGAACTTTCATTAATTGACTTCTATTTGTG CTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATTATGCTTATTATCTTTTGGTTCTCACTTGAACTGCAA GATCATAATGAAACTTGTCACGCCTAAACGAACATGAAATTTCTTGTTTTCTTAGGAATCATCACAACTG TAGCTGCATTTCACCAAGAATGTAGTTTACAGTCATGTACTCAACATCAACCATATGTAGTTGATGACCC GTGTCCTATTCACTTCTATTCTAAATGGTATATTAGAGTAGGAGCTAGAAAATCAGCACCTTTAATTGAA TTGTGCGTGGATGAGGCTGGTTCTAAATCACCCATTCAGTACATCGATATCGGTAATTATACAGTTTCCT GTTTACCTTTTACAATTAATTGCCAGGAACCTAAATTGGGTAGTCTTGTAGTGCGTTGTTCGTTCTATGA AGACTTTTTAGAGTATCATGACGTTCGTGTTGTTTTAGATTTCATCTAAACGAACAAACTAAAATGTCTG ATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACTGGCAG TAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATACT GCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTC CAATTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGG TGGTGACGGTAAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCT GGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGGGAGCCTTGAATACACCAA AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTCAAGGAACAAC ATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGGCAGTCAAGCCTCTTCTCGTTCCTCATCACGT AGTCGCAACAGTTCAAGAAATTCAACTCCAGGCAGCAGTAGGGGAACTTCTCCTGCTAGAATGGCTGGCA ATGGCGGTGATGCTGCTCTTGCTTTGCTGCTGCTTGACAGATTGAACCAGCTTGAGAGCAAAATGTCTGG TAAAGGCCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGCCTCGG CAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAGACGTGGTCCAGAACAAACCC AAGGAAATTTTGGGGACCAGGAACTAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACA ATTTGCCCCCAGCGCTTCAGCGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACG TGGTTGACCTACACAGGTGCCATCAAATTGGATGACAAAGATCCAAATTTCAAAGATCAAGTCATTTTGC TGAATAAGCATATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAAAGGACAAAAAGAAGAAGGC TGATGAAACTCAAGCCTTACCGCAGAGACAGAAGAAACAGCAAACTGTGACTCTTCTTCCTGCTGCAGAT TTGGATGATTTCTCCAAACAATTGCAACAATCCATGAGCAGTGCTGACTCAACTCAGGCCTAAACTCATG CAGACCACACAAGGCAGATGGGCTATATAAACGTTTTCGCTTTTCCGTTTACGATATATAGTCTACTCTT GTGCAGAATGAATTCTCGTAACTACATAGCACAAGTAGATGTAGTTAACTTTAATCTCACATAGCAATCT TTAATCAGTGTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCACCGAGGCCACGCGGAGTAC GATCGAGTGTACAGTGAACAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAAT TTTAGTAGTGCTATCCCCATGTGATTTTAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAA A     Click to Show/Hide

References
1	Mapping the host protein interactome of non-coding regions in SARS-CoV-2 genome. bioRxiv. 2021 Jun; DOI:10.1101/2021.06.19.449092.